result

Gene information

Detail information of g143550

Location

Gene	Chr	Start	End	Strand
g143550	Scaffold_43409:HRSCAF_426495	188670	190390	+

Sequences

CDS

Protein

Gene

>g143550.t1
ATGTTAAATCGTTGGTGGTTCATGGTTTGGAGGTTGGTGGCTACGCTGTCTAGAAAAAGGGGGTAATTTGCGCCATATTATTCCTTCTATATAGGGTATGTGTACATCGCCAATGTTCTCCCATTAAAAGATATATGCTTGACTTTGTCATCAAGTGAAAGATGAACCGCGTGACCCATCCTCCACTTCCAATGCAAGTTCAACATCAAAACATCCACGTTTTTTCAAATTGTTGAACCAATCAAATAATATTTAAACTATAAAATAAAATAAGCATTCGCAAAATTCACGTGTCCTTATTCCCTCCTACTCAATGCTTCTATATAACCAAACTCCAAATCAAATTGGTAACGAAATCCTCAATTACTCACTTTCTTCTTCGCCTTTCACAATATCAAACCATGTCTGCAGCAACAAAGCAAGATAAACCTTCCACCTTCGCCATGACCTGCAATCTTCTGAGCCAATTCATCAAAGAAAAGGGCTCGCTAGGCGATTTGGGACTCGAAATGGCAATCGGTAGTTTTTCAACCGAATTATATTGTTTTTTCTGCTCATTTTAGATCTGAAATCTTTTCGTGTTTAGATCCATTTATTTATTCGCGTGTTATCATTTTTTTAGGCAAAAGCGATACCTATCGGCCACCAACTACGATGAACCTGCTACAAAACGTAGCTGCAGCAGGAACTGGTACGAGAGAAACCGTACCGGAGCGAAACAATACCAAACCCATTGATTTGTTTCCTCAAGCGGCAGAAAATAGGTTCGTGTACAATTTATTTTCAGATCAGTCCCTCTAACTGCAAAAAAGTCAGAAAAGTTTATGTGTGTGTTTATACTTTTGAATTTGTAAATGCAGAAAACCTGAAAGCTCGCAATTGACAATATTTTATGGAGGGAAAGTGATGGTGTTTGATAATTTTCCTGCAAACAAGGCAAATGATTTGATGATGCTAGCAGGAAAAGGATGTGATCTGAAATCAGAGAAATTTAAAACTGCAAATTCGAATTCGAATTTGAATTTGGTTACAGCACCTGCTAACTCTCCAATTGTGCAACCAAGATCCGTCCAAACTGTTGCTTCAGGTATATTTATCGCTCTTCTTCTAGTTTATGGTTCATGCAAGTTTAAAAACCACCTTTTATCTTTGATTTCATGACCCAAGTATCTAGATTATCAGATTAGTATATGTTGTTGATTCAAATCCTTGTCCTACCAAAAACTTAAAAGATAATGGTGTAAACGAGCAATTATTCATCATGTGCTATAAACATATTCATTGTTCATATTCTTCTAGGATGATATGCAAAACCAAATAAGTTGGGTTAAGGATGGAAAATTGCAAGAAAATATAATTATGTTTCAATATATTCAAATGTATTCAGCTTTGCTATGTTTATGTGCATGTATTTGGTATTCTATATCTAAATTTGAGCAAAGATTAATCTGTATCTTTTTCTTACAACAGACTTACCAATTGCAAGAAAAGCTTCACTGCATCGATTTCTTGAGAAGAGAAAGGATAGGTGATCAATCCACTCTAATTTGAATAAAATGCAACAATATTCATAACAATTTTATCCAATTTGAATGTTTATAAATTTCTTTTTATTCTACAGGATTAATGCTAAAGCGCCATATCAAATTAACCAAAAGAAAGAGTTAGGGAATAAGGAAGAGAACCAGCCATGGCTTGCACTGACCCCTACCCTTAATTAA

Functional annotation

Database	accession number	e-value	annotation
nr	XP_020694311.1	2.5e-45	protein TIFY 10a
Swissprot	Q84R94.1	8.2e-33	OsJAZ5
trEMBL	A0A8T3AHT8	3.1e-45	Protein TIFY

Best hit in Arabidopsis

TAIR id	% identity	e-value	bit score	gene aliases	Short description
AT1G74950.1	40.50	2e-32	135	JAZ2;TIFY10B	TIFY domain/Divergent CCT motif family protein

>>>Show top 3 blast result

Query id	Subject id	alignment length	mis matches	gap openings	query start	query end	subject start	subject end	% identity	e-value	bit score
g143550	AT1G74950.1	242	93	10	72	271	15	247	40.50	2e-32	135
g143550	AT1G19180.1	237	105	8	72	272	20	249	37.55	1e-27	120
g143550	AT1G72450.1	215	97	9	74	256	10	213	34.88	5e-22	101

Ortholog group

Species	Genes
Allium cepa	g121422.t1; g143550.t1; g175586.t1; g199998.t1; g321095.t1; g524015.t1; g526236.t1; g529623.t1; g537452.t1
Allium fistulosum	AfisC1G03921; AfisC2G07008; AfisC3G00614; AfisC3G01670; AfisC3G03920; AfisC4G02030; AfisC4G02950; AfisC5G03580; AfisC8G00209; AfisC8G00621; AfisC8G00783
Allium sativum	Asa1G04293.1; Asa1G04294.1; Asa2G00577.1; Asa3G02593.1; Asa4G01696.1
Arabidopsis thaliana	AT1G19180.1; AT1G19180.2; AT1G74950.1
Oryza sativa	LOC_Os03g28940.1; LOC_Os03g28940.2; LOC_Os07g42370.1; LOC_Os07g42370.2; LOC_Os07g42370.3; LOC_Os09g26780.1

Pfam domain

Pfam ID	Pfam name	type	alignment_start	alignment_end	bit_score	Evalue
PF06200.11	tify	Domain	152	184	61.9	2.2e-17
PF09425.7	CCT_2	Motif	228	253	55.0	4.7e-15

Gene Ontology

Accession	Ontology	Name
GO:0005622	C	intracellular
GO:0005575	C	cellular_component
GO:0003674	F	molecular_function
GO:0003712	F	transcription cofactor activity
GO:0003714	F	transcription corepressor activity
GO:0005623	C	cell
GO:0005634	C	nucleus
GO:0043231	C	intracellular membrane-bounded organelle
GO:0006950	P	response to stress
GO:0008150	P	biological_process
GO:0009611	P	response to wounding
GO:0009889	P	regulation of biosynthetic process
GO:0009890	P	negative regulation of biosynthetic process
GO:0009892	P	negative regulation of metabolic process
GO:0009966	P	regulation of signal transduction
GO:0010556	P	regulation of macromolecule biosynthetic process
GO:0010558	P	negative regulation of macromolecule biosynthetic process
GO:0010605	P	negative regulation of macromolecule metabolic process
GO:0010646	P	regulation of cell communication
GO:0019219	P	regulation of nucleobase-containing compound metabolic process
GO:0019222	P	regulation of metabolic process
GO:0023051	P	regulation of signaling
GO:0031323	P	regulation of cellular metabolic process
GO:0031324	P	negative regulation of cellular metabolic process
GO:0031326	P	regulation of cellular biosynthetic process
GO:0031327	P	negative regulation of cellular biosynthetic process
GO:0031347	P	regulation of defense response
GO:0043226	C	organelle
GO:0043227	C	membrane-bounded organelle
GO:0043229	C	intracellular organelle
GO:0044424	C	intracellular part
GO:0044464	C	cell part
GO:0045934	P	negative regulation of nucleobase-containing compound metabolic process
GO:0048519	P	negative regulation of biological process
GO:0048523	P	negative regulation of cellular process
GO:0048583	P	regulation of response to stimulus
GO:0050789	P	regulation of biological process
GO:0050794	P	regulation of cellular process
GO:0050896	P	response to stimulus
GO:0051171	P	regulation of nitrogen compound metabolic process
GO:0051172	P	negative regulation of nitrogen compound metabolic process
GO:0051252	P	regulation of RNA metabolic process
GO:0051253	P	negative regulation of RNA metabolic process
GO:0060255	P	regulation of macromolecule metabolic process
GO:0065007	P	biological regulation
GO:0080090	P	regulation of primary metabolic process
GO:0080134	P	regulation of response to stress
GO:1902679	P	negative regulation of RNA biosynthetic process
GO:1903506	P	regulation of nucleic acid-templated transcription
GO:1903507	P	negative regulation of nucleic acid-templated transcription
GO:2000022	P	regulation of jasmonic acid mediated signaling pathway
GO:2001141	P	regulation of RNA biosynthetic process
GO:0140110

KEGG pathway

KO	Name	Enzyme ID	Pathway	Pathway ID
K13464	JAZ; jasmonate ZIM domain-containing protein	EC:-	Plant hormone signal transduction	ko04075

Expression pattern in different tissues

Expression pattern in BioProjects

Co-expression network