result

Gene information

Detail information of g200835

Location

Gene	Chr	Start	End	Strand
g200835	Scaffold_51033:HRSCAF_434119	299578	301065	+

Sequences

CDS

>g200835.t1
ATGTCTTCAATCTCTCACTCGTCCCCATACGAAACAAACTACTTGCAATTCAGTCCCAAAACACTCCTCTCTTCTTCCCCCGCCTCAACTTTGAACTTGAACAAAAGTTCAAAAAACTCTCTCCAAAATTCAATCGCTCAGTCCGCCACCTTAGAATCCACCATCATCACTTCGGATCATCTAACAAAATCCGATCTCGTGGATTACTTCCTCACCGGGTGCAAACCCAAACCCAAATGGCGAATCGGCACCGAACACGAAAAGTTTGGGTTTGACCGCAACACCCTCCGCCCTATAACCTACTTCCAAATCTCCCAACTCCTCAACACCATCGCTGAAAGGTTCGACTACGAGAAAATCCTCGAAGACGGAGTCAACGTAGTCGGCCTAATGAAGAACAACCTGAGCATCACCCTCGAACCCGGCGGCCAGCTCGAGCTCAGTGGGGCACCCGTCAGTACCATCCACGAAACCCAATCCGAAATCGAGACGCACCTGCACGAGGTGAAATCAGTTGCTTCAGAAATGGGCATTGCCTTCTGCGGAATAGGGTTCAACCCAAAATGGGCGCTGGACCAAATACCCGTGATGCCCAAATCCCGGTACGACATAATGACCTCCTACCTACCCAAAATCGGAAGAACCGGAGTGGACACCATGTTCCGGACATGCACCGTGCAGGTGAACCTGGACTACAGCTCGGAGGCGGACATGGTGAAAAAGTTACGGGTTAGCTTAGCTCTTCAGCCGATTGCGACTGCTATATTTGCGAACTCTCCGTTCAGCGAAGGGAAGGTGAACGGTTTCGTGAGTAAAAGGAGCGATCTGTGGATGGACATGGGTGGGAACCGCGTCGGGATGCTGCCATTTGTGTTTGAGGAAGGGTTCGGGTTCGAAAGGTATGTTGAGTATCTGTTGGACGTGCCGATGTTTCTTGTGAAGAGGGAAGGGAAGTTCGTGGACTGTTCGGGGTTGTCGTTTAGGGATCTCATGAGAGGGGAGCTGTCCGTTTTGCCCGGAGAGTATCCGACGGTAGAAGACTGGGAGGTGCATTTGACGACGGTGTTTCCGGAGGTGAGGACGAAGAAGTTTCTGGAGATGAGAGGAGCAGATGTCGGGCCTGTAAGCACACTGTGTGCGTTGCCTGCGTTTTGGGTTGGGTTGCTGTATGACGAGGTGTCGTTGGAGAGTGCATGGAAGTTGGTTGAAGGGTGGACGAAGGAAGAGAGAGAGGAACTAAGGAAGAATGTTCCGGTAATGGGGTTAAGGACAGGGTTTAGAGGGGGGAGGGTGAAGGAGGTGGCCGAGGAGGTGGTGAAGATGGCGAGAGAGGGGCTGGAGAGAAGACGGTTAGGGGAGGAGGTGTATTTGGATGGAGTGAGGGAGGTGGCTGAGAGTGGGGTGACGGCGGCGGAGAGGTTGGTGGAGAAATTTAGTGGAGAGTGGGGTCGGAGTGTTGATCCAGTTTTTGAAGAGTTGATGTATTAG

Protein

Gene

Functional annotation

Database	accession number	e-value	annotation
nr	XP_031098130.1	7.7e-170	glutamate--cysteine ligase, chloroplastic-like isoform X1
Swissprot	Q1W2L8.2	1.8e-171	Gamma-glutamylcysteine synthetase
trEMBL	I6PBF4	1.6e-169	Glutamate--cysteine ligase

Best hit in Arabidopsis

TAIR id	% identity	e-value	bit score	gene aliases	Short description
AT4G23100.1	58.60	1e-170	596	ATECS1;AtGSH1;CAD2;GSH1;GSHA;PAD2;RML1	glutamate-cysteine ligase

>>>Show top 3 blast result

Query id	Subject id	alignment length	mis matches	gap openings	query start	query end	subject start	subject end	% identity	e-value	bit score
g200835	AT4G23100.3	471	194	1	25	495	53	522	58.60	1e-170	596
g200835	AT4G23100.1	471	194	1	25	495	53	522	58.60	1e-170	596
g200835	AT4G23100.2	419	173	1	25	443	53	470	58.47	1e-151	533

Ortholog group

Species	Genes
Allium cepa	g109554.t1; g109573.t1; g109575.t1; g200835.t1
Allium fistulosum	AfisC2G09013
Allium sativum	Asa6G00503.1
Arabidopsis thaliana
Oryza sativa

Pfam domain

Pfam ID	Pfam name	type	alignment_start	alignment_end	bit_score	Evalue
PF04107.10	GCS2	Family	128	405	277.1	1.5e-82

Gene Ontology

Accession	Ontology	Name
GO:0000003	P	reproduction
GO:0005622	C	intracellular
GO:0005575	C	cellular_component
GO:0000302	P	response to reactive oxygen species
GO:0001101	P	response to acid chemical
GO:0006790	P	sulfur compound metabolic process
GO:0008152	P	metabolic process
GO:0002213	P	defense response to insect
GO:0002376	P	immune system process
GO:0003006	P	developmental process involved in reproduction
GO:0003674	F	molecular_function
GO:0006952	P	defense response
GO:0042742	P	defense response to bacterium
GO:0050832	P	defense response to fungus
GO:0003824	F	catalytic activity
GO:0004357	F	glutamate-cysteine ligase activity
GO:0005623	C	cell
GO:0005737	C	cytoplasm
GO:0043231	C	intracellular membrane-bounded organelle
GO:0006082	P	organic acid metabolic process
GO:0006749	P	glutathione metabolic process
GO:0006518	P	peptide metabolic process
GO:0006575	P	cellular modified amino acid metabolic process
GO:0006725	P	cellular aromatic compound metabolic process
GO:0006750	P	glutathione biosynthetic process
GO:0006807	P	nitrogen compound metabolic process
GO:0006950	P	response to stress
GO:0006955	P	immune response
GO:0006979	P	response to oxidative stress
GO:0007275	P	multicellular organism development
GO:0008150	P	biological_process
GO:0009058	P	biosynthetic process
GO:0009266	P	response to temperature stimulus
GO:0042493	P	response to drug
GO:0009403	P	toxin biosynthetic process
GO:0009404	P	toxin metabolic process
GO:0009408	P	response to heat
GO:0010038	P	response to metal ion
GO:0009507	C	chloroplast
GO:0009532	C	plastid stroma
GO:0009536	C	plastid
GO:0009570	C	chloroplast stroma
GO:0009605	P	response to external stimulus
GO:0009607	P	response to biotic stimulus
GO:0051707	P	response to other organism
GO:0009617	P	response to bacterium
GO:0009620	P	response to fungus
GO:0009628	P	response to abiotic stimulus
GO:0009700	P	indole phytoalexin biosynthetic process
GO:0009719	P	response to endogenous stimulus
GO:0009725	P	response to hormone
GO:0009753	P	response to jasmonic acid
GO:0009791	P	post-embryonic development
GO:0009814	P	defense response, incompatible interaction
GO:0009816	P	defense response to bacterium, incompatible interaction
GO:0009908	P	flower development
GO:0009987	P	cellular process
GO:0010033	P	response to organic substance
GO:0010035	P	response to inorganic substance
GO:0010193	P	response to ozone
GO:0016043	P	cellular component organization
GO:0016143	P	S-glycoside metabolic process
GO:0016144	P	S-glycoside biosynthetic process
GO:0016874	F	ligase activity
GO:0016879	F	ligase activity, forming carbon-nitrogen bonds
GO:0016881	F	acid-amino acid ligase activity
GO:0046677	P	response to antibiotic
GO:0018130	P	heterocycle biosynthetic process
GO:0019184	P	nonribosomal peptide biosynthetic process
GO:0019438	P	aromatic compound biosynthetic process
GO:0019748	P	secondary metabolic process
GO:0019757	P	glycosinolate metabolic process
GO:0019758	P	glycosinolate biosynthetic process
GO:0019760	P	glucosinolate metabolic process
GO:0019761	P	glucosinolate biosynthetic process
GO:0046686	P	response to cadmium ion
GO:0022414	P	reproductive process
GO:0033554	P	cellular response to stress
GO:0032501	P	multicellular organismal process
GO:0032502	P	developmental process
GO:0033036	P	macromolecule localization
GO:0033037	P	polysaccharide localization
GO:0034641	P	cellular nitrogen compound metabolic process
GO:0042221	P	response to chemical
GO:0042398	P	cellular modified amino acid biosynthetic process
GO:0042430	P	indole-containing compound metabolic process
GO:0042435	P	indole-containing compound biosynthetic process
GO:0042545	P	cell wall modification
GO:0043043	P	peptide biosynthetic process
GO:0043207	P	response to external biotic stimulus
GO:0043226	C	organelle
GO:0043227	C	membrane-bounded organelle
GO:0043229	C	intracellular organelle
GO:0043436	P	oxoacid metabolic process
GO:0043603	P	cellular amide metabolic process
GO:0043604	P	amide biosynthetic process
GO:0044237	P	cellular metabolic process
GO:0044249	P	cellular biosynthetic process
GO:0044271	P	cellular nitrogen compound biosynthetic process
GO:0044272	P	sulfur compound biosynthetic process
GO:0044281	P	small molecule metabolic process
GO:0044422	C	organelle part
GO:0044424	C	intracellular part
GO:0044434	C	chloroplast part
GO:0044435	C	plastid part
GO:0044444	C	cytoplasmic part
GO:0044446	C	intracellular organelle part
GO:0044464	C	cell part
GO:0044550	P	secondary metabolite biosynthetic process
GO:0045087	P	innate immune response
GO:0045229	P	external encapsulating structure organization
GO:0046217	P	indole phytoalexin metabolic process
GO:0046483	P	heterocycle metabolic process
GO:0048367	P	shoot system development
GO:0048608	P	reproductive structure development
GO:0048731	P	system development
GO:0048856	P	anatomical structure development
GO:0050896	P	response to stimulus
GO:0051179	P	localization
GO:0051186	P	cofactor metabolic process
GO:0051188	P	cofactor biosynthetic process
GO:0051641	P	cellular localization
GO:0051704	P	multi-organism process
GO:0051716	P	cellular response to stimulus
GO:0052314	P	phytoalexin metabolic process
GO:0052315	P	phytoalexin biosynthetic process
GO:0052386	P	cell wall thickening
GO:0052482	P	defense response by cell wall thickening
GO:0052542	P	defense response by callose deposition
GO:0052543	P	callose deposition in cell wall
GO:0052544	P	defense response by callose deposition in cell wall
GO:0052545	P	callose localization
GO:0061458	P	reproductive system development
GO:0070727	P	cellular macromolecule localization
GO:0071554	P	cell wall organization or biogenesis
GO:0071555	P	cell wall organization
GO:0071704	P	organic substance metabolic process
GO:0071840	P	cellular component organization or biogenesis
GO:0090567	P	reproductive shoot system development
GO:0098542	P	defense response to other organism
GO:1901135	P	carbohydrate derivative metabolic process
GO:1901137	P	carbohydrate derivative biosynthetic process
GO:1901360	P	organic cyclic compound metabolic process
GO:1901362	P	organic cyclic compound biosynthetic process
GO:1901564	P	organonitrogen compound metabolic process
GO:1901566	P	organonitrogen compound biosynthetic process
GO:1901576	P	organic substance biosynthetic process
GO:1901657	P	glycosyl compound metabolic process
GO:1901659	P	glycosyl compound biosynthetic process
GO:1901700	P	response to oxygen-containing compound

KEGG pathway

KO	Name	Enzyme ID	Pathway	Pathway ID
K01919	gshA; glutamate--cysteine ligase	EC:6.3.2.2	Cysteine and methionine metabolism	ko00270
K01919	gshA; glutamate--cysteine ligase	EC:6.3.2.2	Glutathione metabolism	ko00480

Expression pattern in different tissues

Expression pattern in BioProjects

Co-expression network