result

Gene information

Detail information of g253389

Location

Gene	Chr	Start	End	Strand
g253389	Scaffold_57810:HRSCAF_440896	288418	290123	-

Sequences

CDS

Protein

Gene

>g253389.t1
ATGGATTGTGTTGAAAACTACGTAGATGAGCTGATGATGCCAGGATTTAGATTTCACCCAACAGATGAAGAGCTAGTTAGCTTTTACCTCAAGAGAAAAATTCAGCAGAAGCCTCCTAGCATAGAACTGATTAGACAGTTGGATATCTACAAATATGATCCCTGGGATTTACCAAGTAAGTAAACAAAACACTTTAGTATCTAGCCTGCTCGATACTGATTTCTTGTCCTATCATCTTAATAGCATATTTTACTATCAAAAATGATCATGGTTCATATAGAAAACTGGCTTTAGGGATTTTACAGTTTTTGCATGCATATATAAAGTACTCTGATCTTACTGTTGCTGTATAATATGTTTTGCCAATTTAGGCATGCTCAAAATATTGTTAAAGGACTGCAAAATGATATTTTTTATATGTTGACTTACTTGAGCAGAAATGAAAGCTTAATTACTTAAACTCTAAGTAGATACTTTCTAGGGCTCAACATATATTGATTGTTTGTTATTGTTTATTACTGACATCATAATTTTTTTGTGATTTGTTAAGTTGAAAATATGCGTCAGTCCTCATTGTTATCTATTTGTTTGTCTATATACCTTTTTTTTTCCATGTTTGTATCATACATATTTGATAAAGGACATACTTTTGGACGTAAATAAATGCTTCTCATTTTTCAAACAATGTTAGCTAACCATATTATATTATAATATTATATAATGCATGTGTATGAGAAATGAGAATAAATGTTGAATGCTACTTTTTCTAACTATTATCACTTTCTCCGAATGAAGATATGGTGACTACGGGAGAAAAAGAGTGGTATTTTTACTGTCCAAGAGACCGTAAATATAAAAACAGCGCACGCCCAAACAGAGTCACAGGAGCTGGGTTCTGGAAAGCTACAGGAACTGATAGACCAATTTACTCCTCTGAAAGAAATAAATGCATAGGGCTAAAAAAGTCGCTTGTATTTTACAAGGGTAGAGCTGCAAAAGGCACCAAAACTGACTGGATGATGCATGAATTCAGACTTCCTTCTGCCATCGATTCATCCTTCCCCAAAAGAACCCTCGAAAAGACAATTCCCATCGACGTATGTCTGCTTATAATAACAGAAGAGTAAATAACTGCACCATTGGCGGGCAATGAACAATATAAACTTTAGTTAACATGTTTTTTGGAATATTTGCAGGAAGCATGGGTCATTTGTAAGATATTCAAGAAGACGAACTCTTTTGCGCAAAGAGCGATAGCTCGGTCATGGGGATCACAGTTCCAAGAAACAATCACTACCGAATCAGACATGTTTGCAAATCGACTACGTGTATCAGACACCATCTCTTGCAGTACTACGTCTATTACGAGCATTGAGCCATCTTCTTCTTCGGTTCAATTCAACTTTCCTGCATTAGAATTTGACTTGGTCGATTTTGCAATTTCTCAAGAAGATGTGCCACTGGACTCTGTGCAGCTCAACTTTAGCCAGGCTCCACATAGTACTGAATTGAGGGTTGGTTTGCCTTTGGGATTTAATGATGAGACAAGAGCAAGCCAAGATAGGATCACAGTTACTGATACACAGGGGATTGATTTTCCCTTCAATTTGTCACCTGTCATATGTGAGGACTGGAAATCAAATTTGCTGTGGGATTCGCCTGCTTTTACCGATGAGATGTCTACTGGATTGTTCACAAACGTATGA

Functional annotation

Database	accession number	e-value	annotation
nr	XP_020255504.1	1.4e-98	protein FEZ-like
Swissprot	Q9ZVH0.1	4.5e-78	NAC domain-containing protein 9
trEMBL	A0A5P1F6X4	9.9e-99	NAC domain-containing protein

Best hit in Arabidopsis

TAIR id	% identity	e-value	bit score	gene aliases	Short description
AT1G26870.1	64.35	7e-77	284	ANAC009;FEZ	NAC (No Apical Meristem) domain transcriptional regulator superfamily protein

>>>Show top 3 blast result

Query id	Subject id	alignment length	mis matches	gap openings	query start	query end	subject start	subject end	% identity	e-value	bit score
g253389	AT1G26870.1	216	71	4	8	222	19	229	64.35	7e-77	284
g253389	AT5G39820.1	194	50	5	4	183	13	205	66.49	1e-73	273
g253389	AT2G43000.1	165	56	2	9	173	15	170	60.61	8e-59	224

Ortholog group

Species	Genes
Allium cepa	g183050.t1; g205624.t1; g253389.t1; g253410.t1; g253415.t1; g308295.t1
Allium fistulosum	AfisC1G03412; AfisC1G03417; AfisC1G03418; AfisC1G03419; AfisC4G00755
Allium sativum	Asa4G00742.1; Asa7G05587.1; Asa7G05588.1; Asa7G05591.1
Arabidopsis thaliana	AT1G26870.1; AT5G39820.1
Oryza sativa	LOC_Os08g33910.1

Pfam domain

Pfam ID	Pfam name	type	alignment_start	alignment_end	bit_score	Evalue
PF02365.12	NAM	Family	14	139	91.4	4.6e-26

Gene Ontology

Accession	Ontology	Name
GO:0005622	C	intracellular
GO:0005575	C	cellular_component
GO:0003674	F	molecular_function
GO:0003700	F	transcription factor activity, sequence-specific DNA binding
GO:0005623	C	cell
GO:0005634	C	nucleus
GO:0043231	C	intracellular membrane-bounded organelle
GO:0006355	P	regulation of transcription, DNA-templated
GO:0007275	P	multicellular organism development
GO:0008150	P	biological_process
GO:0009719	P	response to endogenous stimulus
GO:0009725	P	response to hormone
GO:0009733	P	response to auxin
GO:0009786	P	regulation of asymmetric cell division
GO:0009889	P	regulation of biosynthetic process
GO:0009987	P	cellular process
GO:0010033	P	response to organic substance
GO:0010468	P	regulation of gene expression
GO:0010556	P	regulation of macromolecule biosynthetic process
GO:0017145	P	stem cell division
GO:0019219	P	regulation of nucleobase-containing compound metabolic process
GO:0019222	P	regulation of metabolic process
GO:0022622	P	root system development
GO:0031323	P	regulation of cellular metabolic process
GO:0031326	P	regulation of cellular biosynthetic process
GO:0032501	P	multicellular organismal process
GO:0032502	P	developmental process
GO:0042221	P	response to chemical
GO:0043226	C	organelle
GO:0043227	C	membrane-bounded organelle
GO:0043229	C	intracellular organelle
GO:0044424	C	intracellular part
GO:0044464	C	cell part
GO:0045770	P	positive regulation of asymmetric cell division
GO:0048103	P	somatic stem cell division
GO:0048364	P	root development
GO:0048518	P	positive regulation of biological process
GO:0048522	P	positive regulation of cellular process
GO:0048731	P	system development
GO:0048829	P	root cap development
GO:0048856	P	anatomical structure development
GO:0050789	P	regulation of biological process
GO:0050794	P	regulation of cellular process
GO:0050896	P	response to stimulus
GO:0051171	P	regulation of nitrogen compound metabolic process
GO:0051252	P	regulation of RNA metabolic process
GO:0051301	P	cell division
GO:0051302	P	regulation of cell division
GO:0051781	P	positive regulation of cell division
GO:0060255	P	regulation of macromolecule metabolic process
GO:0065007	P	biological regulation
GO:0080090	P	regulation of primary metabolic process
GO:0099402	P	plant organ development
GO:1903506	P	regulation of nucleic acid-templated transcription
GO:2000112	P	regulation of cellular macromolecule biosynthetic process
GO:2001141	P	regulation of RNA biosynthetic process
GO:0140110

KEGG pathway

KO	Name	Enzyme ID	Pathway	Pathway ID
-	-	-	-	-

Expression pattern in different tissues

Expression pattern in BioProjects

Co-expression network