result

Gene information

Detail information of g263369

Location

Gene	Chr	Start	End	Strand
g263369	CHR7	62502672	62503673	-

Sequences

CDS

>g263369.t1
ATGGATAATTTTGGTTGGGAAATCAGTTCATCAATGATGCCACCTAATATATGGGTCAATCAATATGAAAACAATATTTGTGGGACAGAAGCCGATTATGAAACATTTCAAAATTCAAATGTAGAGATGCAAGTTGCAGATAACTCAAGCATGGGGATCGGAGTTAATGAAATGTTGGGGAGGATGGCAGTCCCTGCTAATTTCAACTCCATAGCCAACAATGTGGATCTTGATAACTTTTTCTTCACTTGCCATCAACCTGAAATTACCAATTCATTGGGTCTGCTACCGGAAGATTTAATACAGTCTTCTCAAGAGCTCCAAATACTTAACCCAAGAGTAAACTATGATTATATGATCAGCAGCTGTAACTTCTCATCAGGAGAATCCGAAGCAGCATCACAAGGCTCTTCACAAACAAACTCATCGAAACAAAACAAAAATTCAAAGAGGAAGCTTGAAGATATGCAGTCTTATTATTCTCAATGTGCGAGTATTGCAGAAAAAGGATTTCAAATACATTTTGACAGACCTAAAAACTCGAAAAGACCCAATTTTTTGAAGGAAACTTCAGGTGCAAACATTGATTTTAGACAGGAAAAGAACAAAGAAAGTTTCGAGGCTGATACAGAAGCAATCGCTGAAGTAAAAGAAATGATGTACAAAGCAGCTGCAATGAGACCAATAAATCTAGTACTGGCAGAGACTGCAGTTGATAGACCAAAAAGGAAGAACGTGAAGATATCAAGCGATCCACAGACAGTGGCAGCAAGACAAAGAAGAGAAAGAATAAGTGAAAGATTGAGAGTTCTTCAAAAGCTAGTCCCTGGTGGCAGTAAAATGGATACTGCTTCTATGCTCCATGAAGCTGCTAACTATCTTAAGTTTTTGAAGTCTCAAGTTAGTACTTTGGAAACCCTAGGTACAAATTCAAATTCATCATCAAATGATTTCCATGCCCCTAATTTCTTGATGTTTTGTAAGATGGACAATCCTTTGTAG

Protein

Gene

Functional annotation

Database	accession number	e-value	annotation
nr	XP_009395775.1	6.8e-45	PREDICTED: transcription factor bHLH87-like
Swissprot	Q8S3D2.1	1.4e-34	bHLH transcription factor bHLH087
trEMBL	A0A7M3UQK9	2.1e-48	BHLH transcription factor

Best hit in Arabidopsis

TAIR id	% identity	e-value	bit score	gene aliases	Short description
AT3G21330.1	60.99	2e-40	162		basic helix-loop-helix (bHLH) DNA-binding superfamily protein

>>>Show top 3 blast result

Query id	Subject id	alignment length	mis matches	gap openings	query start	query end	subject start	subject end	% identity	e-value	bit score
g263369	AT3G21330.1	141	50	4	170	307	196	334	60.99	2e-40	162
g263369	AT4G00120.1	90	35	1	216	305	88	175	58.89	5e-25	112
g263369	AT3G50330.1	98	37	1	208	305	87	182	60.20	1e-21	100

Ortholog group

Species	Genes
Allium cepa	g237488.t1; g263369.t1
Allium fistulosum	AfisC6G01562
Allium sativum	Asa3G04162.1
Arabidopsis thaliana	AT3G21330.1
Oryza sativa	LOC_Os01g51140.1; LOC_Os01g51140.2

Pfam domain

Pfam ID	Pfam name	type	alignment_start	alignment_end	bit_score	Evalue
PF00010.23	HLH	Domain	257	297	23.4	4e-05

Gene Ontology

Accession	Ontology	Name
GO:0005622	C	intracellular
GO:0005575	C	cellular_component
GO:0005623	C	cell
GO:0005634	C	nucleus
GO:0043231	C	intracellular membrane-bounded organelle
GO:0006355	P	regulation of transcription, DNA-templated
GO:0008150	P	biological_process
GO:0009889	P	regulation of biosynthetic process
GO:0010468	P	regulation of gene expression
GO:0010556	P	regulation of macromolecule biosynthetic process
GO:0019219	P	regulation of nucleobase-containing compound metabolic process
GO:0019222	P	regulation of metabolic process
GO:0031323	P	regulation of cellular metabolic process
GO:0031326	P	regulation of cellular biosynthetic process
GO:0043226	C	organelle
GO:0043227	C	membrane-bounded organelle
GO:0043229	C	intracellular organelle
GO:0044424	C	intracellular part
GO:0044464	C	cell part
GO:0048580	P	regulation of post-embryonic development
GO:0048583	P	regulation of response to stimulus
GO:0048586	P	regulation of long-day photoperiodism, flowering
GO:0048587	P	regulation of short-day photoperiodism, flowering
GO:0050789	P	regulation of biological process
GO:0050793	P	regulation of developmental process
GO:0050794	P	regulation of cellular process
GO:0051171	P	regulation of nitrogen compound metabolic process
GO:0051239	P	regulation of multicellular organismal process
GO:0051252	P	regulation of RNA metabolic process
GO:0060255	P	regulation of macromolecule metabolic process
GO:0065007	P	biological regulation
GO:0080090	P	regulation of primary metabolic process
GO:1903506	P	regulation of nucleic acid-templated transcription
GO:2000026	P	regulation of multicellular organismal development
GO:2000028	P	regulation of photoperiodism, flowering
GO:2000112	P	regulation of cellular macromolecule biosynthetic process
GO:2000241	P	regulation of reproductive process
GO:2001141	P	regulation of RNA biosynthetic process

KEGG pathway

KO	Name	Enzyme ID	Pathway	Pathway ID
-	-	-	-	-

Expression pattern in different tissues

Expression pattern in BioProjects

Co-expression network