result

Gene information

Detail information of g263822

Location

Gene	Chr	Start	End	Strand
g263822	Scaffold_59226:HRSCAF_442312	98933	100804	+

Sequences

CDS

Protein

Gene

>g263822.t1
ATGATTGTCGGACCCATAAAAACACTATTCATGGACGAAATATCTACCGGTTTAGACAGCTCTACTACCTTCCAGATTGTTAAATGTCTTCAACAAGTTGCACATCTAGGAAAAACCATAATATTAATGTCCCTTCTTCAACCAGCTCCTGAAACTTTTGATTCATTTGATGATATCATCCTTTTATCCGATGGTATAATTGTTTATCAGGGCCCAAAAGAACATGTGTTGGAATTCTTCGAGACATGTGGGTTTTCCTGCCTAGAAAGGAAAGATGCAGCTGACTTCTTGCAAGAGGTACAATATAAGATCACAATAATGACCCAGCTCTTTCATTATGTAGTTCTTCTTTATACGAGTATGTATTCATTTACTTATCACTGAGTTATGCTCTCTTAGGTGCACTAGAATACATATAGCATCAATTTGCTGCTAATGTTGAAATACAGAAGTGCTTTTCCCTATTAAATATTTATTATATAAGAAATATATATCTTTATTTATTGGACCTACTTAGGTGCTCTTACTTCACTTCCATCACTTAAAAGACATGATGATGCTCCTAATGAATTTTCTGTTCAAACTGATCTTTCTTTAATATAATTGAATCAAACTCAATGTTTTCCTAATATGGTTCTTCGTAATTGATATAATTGGATCGATAACGCTATTATGTCTTGTCTTAGATCATGGACTATGGAGGAAAAGGCCGATATTCCAATACCAATGCAATAGAAATCGATCCTGAAGCCTTCAATACAGCTAGCAATGATGCTTGGAGTCAATCATTGAACGAACAATCAATTTGGCCAACCAAAGATGACTATTAAGTCTGGAACAGTGACTCCACTCCTGAGCAACCTTCTACTAAAAAACCAAGGACTCAACCACAAACTGATTCCAACAGCAAATTGAAAGCCATAGGCAAAATGTTCTTCAAAACGGAACTATGCAGCAAGTTCCGTGCAGGAACTTGTCCATACATAATAAACTGCAATTTTGCAATTGTCGTGATGGTGAATGGTGATGAGGATGTTGGTTACGATTTCGTGGTTGGCCGGTGTAGTAGTTTCAGGTGATGCGGAAGGTTGTCAGCAATGTGATTGGAAGTAGGGAAGGGTTGTTGTGGTAATTGTCGTGATGAGGTTGGATGGGAACAGAGTTTGAAGCTGCAGTGATCAAAGTGCACTACGGTTTGGTTAAGGCAAGGGGAAGTTGAAGTAAGGGATGCATATAAGTAGGGGATGTAGAGGCAATGAAGTGAAGAACGTGAAGTTTTAGTGAGTTATGGCTATGAAGTGATATTTTAGATTGAATGAAGTGACTGGAGAGGTGCAGTGGATGGGATTGTTGTGGAAGTATAGGGTGCTGAGTTGATATTTGGTTTAAAGTGGTAATATTCAGTGGTTGAATGTTGAATAGAGCTTGATGATTGTTCAGGTAATTGATGTCAGAGGCAATTGCACTAGTGAGGTTGATGGAGTATGTTTGCTCTGTGGCAGTTAGCGATGTGTGTAGTGAGGTGGATGGGGGTTATTGGAAAAAGCTGCTGTGTAATGGTCGGAGGTGGACTTGGAGGCGGTGGATGGTTGTCCCTGGTGGTAAATGAAGGTAATATTAATGGAGTAGTTTGGATGGTTTAATGGGATGAATGTATAGCATAAATGAATGGCAGAGGTGAAGTTGTGGTATGTCAGTAGATGGATTGTTAGTCTGAAGTGGATGGTTTGCTGTGTGAATATGCAGATGGTCGGGCAGCTTGGTCGCAGGTTGAATGGATGGGGAGCGTTTATAGAGGAGGGAATTGTTAACAGAGATAGAAAATATGTGACAAAGAATGTAAAGTTGCAAATATGTAAACAAACAATGTAA

Functional annotation

Database	accession number	e-value	annotation
nr	XP_008659680.1	6.8e-40	ABC transporter G family member 42
Swissprot	Q5Z9S8.1	6.0e-41	Pleiotropic drug resistance protein 12
trEMBL	A0A1D6P1Y9	4.9e-40	ABC transporter G family member 29

Best hit in Arabidopsis

TAIR id	% identity	e-value	bit score	gene aliases	Short description
AT1G15210.1	72.48	2e-42	170	ABCG35;ATPDR7;PDR7	pleiotropic drug resistance 7

>>>Show top 3 blast result

Query id	Subject id	alignment length	mis matches	gap openings	query start	query end	subject start	subject end	% identity	e-value	bit score
g263822	AT1G15210.1	109	30	0	1	109	354	462	72.48	2e-42	170
g263822	AT1G15210.1	86	56	3	2	82	1006	1090	27.91	2e-06	50.1
g263822	AT1G59870.1	109	31	0	1	109	356	464	71.56	8e-42	167

Ortholog group

Species	Genes
Allium cepa	g105297.t1; g117126.t1; g130946.t1; g131877.t1; g263822.t1; g284355.t1; g29507.t1; g393033.t1; g502588.t1; g520180.t1
Allium fistulosum	AfisC1G04282; AfisC3G05777
Allium sativum
Arabidopsis thaliana
Oryza sativa

Pfam domain

Pfam ID	Pfam name	type	alignment_start	alignment_end	bit_score	Evalue
-	-	-	-	-	-	-

Gene Ontology

Accession	Ontology	Name
GO:0005886	C	plasma membrane
GO:0000041	P	transition metal ion transport
GO:0005622	C	intracellular
GO:0005575	C	cellular_component
GO:0016021	C	integral component of membrane
GO:0001101	P	response to acid chemical
GO:0006790	P	sulfur compound metabolic process
GO:0008152	P	metabolic process
GO:0002376	P	immune system process
GO:0003674	F	molecular_function
GO:0042623	F	ATPase activity, coupled
GO:0016020	C	membrane
GO:0006952	P	defense response
GO:0042742	P	defense response to bacterium
GO:0050832	P	defense response to fungus
GO:0003824	F	catalytic activity
GO:0046873	F	metal ion transmembrane transporter activity
GO:0042626	F	ATPase activity, coupled to transmembrane movement of substances
GO:0017111	F	nucleoside-triphosphatase activity
GO:0005739	C	mitochondrion
GO:0005773	C	vacuole
GO:0005215	F	transporter activity
GO:0022857	F	transmembrane transporter activity
GO:0005623	C	cell
GO:0005737	C	cytoplasm
GO:0005774	C	vacuolar membrane
GO:0043231	C	intracellular membrane-bounded organelle
GO:0006082	P	organic acid metabolic process
GO:0016887	F	ATPase activity
GO:0006725	P	cellular aromatic compound metabolic process
GO:0006807	P	nitrogen compound metabolic process
GO:0006810	P	transport
GO:0006811	P	ion transport
GO:0006812	P	cation transport
GO:0030001	P	metal ion transport
GO:0006855	P	drug transmembrane transport
GO:0006950	P	response to stress
GO:0006955	P	immune response
GO:0008150	P	biological_process
GO:0008324	F	cation transmembrane transporter activity
GO:0015086	F	cadmium ion transmembrane transporter activity
GO:0009056	P	catabolic process
GO:0042493	P	response to drug
GO:0009507	C	chloroplast
GO:0009526	C	plastid envelope
GO:0009536	C	plastid
GO:0009605	P	response to external stimulus
GO:0009607	P	response to biotic stimulus
GO:0051707	P	response to other organism
GO:0009617	P	response to bacterium
GO:0009620	P	response to fungus
GO:0009627	P	systemic acquired resistance
GO:0009719	P	response to endogenous stimulus
GO:0009725	P	response to hormone
GO:0009733	P	response to auxin
GO:0009737	P	response to abscisic acid
GO:0009814	P	defense response, incompatible interaction
GO:0009817	P	defense response to fungus, incompatible interaction
GO:0009889	P	regulation of biosynthetic process
GO:0009941	C	chloroplast envelope
GO:0009987	P	cellular process
GO:0010033	P	response to organic substance
GO:0010243	P	response to organonitrogen compound
GO:0014070	P	response to organic cyclic compound
GO:0015075	F	ion transmembrane transporter activity
GO:0015318	F	inorganic solute uptake transmembrane transporter activity
GO:0015399	F	primary active transmembrane transporter activity
GO:0015405	F	P-P-bond-hydrolysis-driven transmembrane transporter activity
GO:0015691	P	cadmium ion transport
GO:0015850	P	organic hydroxy compound transport
GO:0015893	P	drug transport
GO:0016043	P	cellular component organization
GO:0016143	P	S-glycoside metabolic process
GO:0016145	P	S-glycoside catabolic process
GO:0016462	F	pyrophosphatase activity
GO:0016787	F	hydrolase activity
GO:0016817	F	hydrolase activity, acting on acid anhydrides
GO:0016818	F	hydrolase activity, acting on acid anhydrides, in phosphorus-containing anhydrides
GO:0019222	P	regulation of metabolic process
GO:0019439	P	aromatic compound catabolic process
GO:0019748	P	secondary metabolic process
GO:0019757	P	glycosinolate metabolic process
GO:0019759	P	glycosinolate catabolic process
GO:0019760	P	glucosinolate metabolic process
GO:0019762	P	glucosinolate catabolic process
GO:0022804	F	active transmembrane transporter activity
GO:0022890	F	inorganic cation transmembrane transporter activity
GO:0033554	P	cellular response to stress
GO:0070887	P	cellular response to chemical stimulus
GO:0031090	C	organelle membrane
GO:0031224	C	intrinsic component of membrane
GO:0031323	P	regulation of cellular metabolic process
GO:0031326	P	regulation of cellular biosynthetic process
GO:0031347	P	regulation of defense response
GO:0031348	P	negative regulation of defense response
GO:0031967	C	organelle envelope
GO:0031975	C	envelope
GO:0032870	P	cellular response to hormone stimulus
GO:0033036	P	macromolecule localization
GO:0033037	P	polysaccharide localization
GO:0033993	P	response to lipid
GO:0034220	P	ion transmembrane transport
GO:0034641	P	cellular nitrogen compound metabolic process
GO:0042221	P	response to chemical
GO:0042343	P	indole glucosinolate metabolic process
GO:0042344	P	indole glucosinolate catabolic process
GO:0042430	P	indole-containing compound metabolic process
GO:0042436	P	indole-containing compound catabolic process
GO:0042545	P	cell wall modification
GO:0043207	P	response to external biotic stimulus
GO:0043226	C	organelle
GO:0043227	C	membrane-bounded organelle
GO:0043229	C	intracellular organelle
GO:0043436	P	oxoacid metabolic process
GO:0043455	P	regulation of secondary metabolic process
GO:0043492	F	ATPase activity, coupled to movement of substances
GO:0044237	P	cellular metabolic process
GO:0044248	P	cellular catabolic process
GO:0044270	P	cellular nitrogen compound catabolic process
GO:0044273	P	sulfur compound catabolic process
GO:0044281	P	small molecule metabolic process
GO:0044422	C	organelle part
GO:0044424	C	intracellular part
GO:0044425	C	membrane part
GO:0044434	C	chloroplast part
GO:0044435	C	plastid part
GO:0044437	C	vacuolar part
GO:0044444	C	cytoplasmic part
GO:0044446	C	intracellular organelle part
GO:0044464	C	cell part
GO:0045087	P	innate immune response
GO:0045229	P	external encapsulating structure organization
GO:0046483	P	heterocycle metabolic process
GO:0046700	P	heterocycle catabolic process
GO:0046915	F	transition metal ion transmembrane transporter activity
GO:0048519	P	negative regulation of biological process
GO:0048583	P	regulation of response to stimulus
GO:0048585	P	negative regulation of response to stimulus
GO:0050789	P	regulation of biological process
GO:0050794	P	regulation of cellular process
GO:0050896	P	response to stimulus
GO:0051179	P	localization
GO:0051234	P	establishment of localization
GO:0051641	P	cellular localization
GO:0051704	P	multi-organism process
GO:0051716	P	cellular response to stimulus
GO:0052386	P	cell wall thickening
GO:0052482	P	defense response by cell wall thickening
GO:0052542	P	defense response by callose deposition
GO:0052543	P	callose deposition in cell wall
GO:0052544	P	defense response by callose deposition in cell wall
GO:0052545	P	callose localization
GO:0055085	P	transmembrane transport
GO:0065007	P	biological regulation
GO:0070574	P	cadmium ion transmembrane transport
GO:0070727	P	cellular macromolecule localization
GO:0070838	P	divalent metal ion transport
GO:0071229	P	cellular response to acid chemical
GO:0071310	P	cellular response to organic substance
GO:0071365	P	cellular response to auxin stimulus
GO:0071366	P	cellular response to indolebutyric acid stimulus
GO:0071407	P	cellular response to organic cyclic compound
GO:0071417	P	cellular response to organonitrogen compound
GO:0071495	P	cellular response to endogenous stimulus
GO:0071554	P	cell wall organization or biogenesis
GO:0071555	P	cell wall organization
GO:0071702	P	organic substance transport
GO:0071704	P	organic substance metabolic process
GO:0071840	P	cellular component organization or biogenesis
GO:0071944	C	cell periphery
GO:0072511	P	divalent inorganic cation transport
GO:0080026	P	response to indolebutyric acid
GO:0080134	P	regulation of response to stress
GO:0097305	P	response to alcohol
GO:0098542	P	defense response to other organism
GO:0098588	C	bounding membrane of organelle
GO:0098655	P	cation transmembrane transport
GO:0098660	P	inorganic ion transmembrane transport
GO:0098662	P	inorganic cation transmembrane transport
GO:0098805	C	whole membrane
GO:1900376	P	regulation of secondary metabolite biosynthetic process
GO:1901135	P	carbohydrate derivative metabolic process
GO:1901136	P	carbohydrate derivative catabolic process
GO:1901140	P	p-coumaryl alcohol transport
GO:1901141	P	regulation of lignin biosynthetic process
GO:1901360	P	organic cyclic compound metabolic process
GO:1901361	P	organic cyclic compound catabolic process
GO:1901564	P	organonitrogen compound metabolic process
GO:1901565	P	organonitrogen compound catabolic process
GO:1901575	P	organic substance catabolic process
GO:1901657	P	glycosyl compound metabolic process
GO:1901658	P	glycosyl compound catabolic process
GO:1901698	P	response to nitrogen compound
GO:1901699	P	cellular response to nitrogen compound
GO:1901700	P	response to oxygen-containing compound
GO:1901701	P	cellular response to oxygen-containing compound
GO:2000762	P	regulation of phenylpropanoid metabolic process

KEGG pathway

KO	Name	Enzyme ID	Pathway	Pathway ID
-	-	-	-	-

Expression pattern in different tissues

Expression pattern in BioProjects

Co-expression network