result

Gene information

Detail information of g293484

Location

Gene	Chr	Start	End	Strand
g293484	CHR3	70215132	70216520	-

Sequences

CDS

>g293484.t1
ATGGGATCAGATATGAAAGGGAGTGTATTGATGCAAAAGTATGAAATAGGAAGAATGCTTGGACAAGGAACATTTGCCAAAGTTTATCATGCACGTAATCTTGTCACATCTCAAAATGTTGCTTTAAAGGTTATCGACAAAGAAAAAGTTTTGAAAGTTGGGCTTATGGATCAAATCAAACGAGAGATTTCAATTATGAGATTAGTGAGGCATCCCCATATTGTTCAGCTTTATGAAGTCATGGCAACAAAAAACAAAATTTATTTTGTTCTTGAATACGTTAAAGGAGGTGAGCTATTCAACAAGGTTGCTAAAGGGAAAGTCAAAGAAGACGTAGCAAGAAAATATTTTCAGCAACTCATTAGTGCCGTGGACTTTTGCCATAGTAGAGGTGTTTACCATCGTGATTTGAAACCTGAAAATCTTTTGTTGGATGAAAATGGAAATTTGAAGGTTTCGGATTTTGGTCTGAGTGCCTTTGCCGAGTGCAAGAGACAAGATGGCTTGCTACACACCACATGTGGGACTCCTGCTTACGTTGCTCCTGAAGTTATCAATAGAAAAGGATATGATGGGGCTAAAGCTGATATATGGTCATGTGGCGTGATATTATATGTTCTACTAGCAGGTTATCTCCCTTTCCACGATCCAAATTTAATGGAGATGTATAGAAAGATTGGAAAGTCTGAATTCAAGTACCCAAACTGGTTTCCATCAGACGTTAGAAGGCTCATCTCTAAAATTCTTGACCCAAATCCAAATACTAGAATTTCAATGTCAAAAATAATGGAGAATCCATGGGTTAAAAAAGGATTTGACCATAAATTGATTAAAAATGAAGTGATAGCAAAAGATACAGCACTTATGGATGTTGATTCAGTTTTTGATTCCTCTGGTGAGAAGGTTACTGATGAGAAGCAGGATATCATGAAACTTGCAAACTTGAATGCCTTTGACATTATTTCACTTTCAGCTGGATTTGATCTCTCGGGTTTGTTCGAAGAAGGCGACATAAGGAGAGAAGCCAGATTTACGTCTACCAAGCCAGTGGCAAGTATTATTTCAAAGATTGAAGAGATTGCTAGTAAATTGAGATTCAAAGTGAAGAAGAAAGATGATGGTGTTATAAAACTGGAAAGTGCAAAAGAAGGTCGAAAAGGGGTTTTGGGCATTGATGCTGAAATCTTTGAGCTTACTCCTTTGTTTCATTTAGTTGAGATAAAGAAAACAAATGGTGATACGTTAGAATATCAAAAAGTATGGACTCAAGAGATGAGGCCTGCCCTTAAAGACATTGTTTGGGCATGGCAAGGGGATCAGCCAGTTCAGCCGCAAAATATTCCAGCTTTGCCACCACCACCTGCACCTCAGCTGGAGCAAGAAGTATAA

Protein

Gene

Functional annotation

Database	accession number	e-value	annotation
nr	XP_020273268.1	1.8e-213	CBL-interacting protein kinase 2-like
Swissprot	Q7X996.1	1.7e-192	OsCIPK02
trEMBL	A0A5P1E9B2	1.3e-213	non-specific serine/threonine protein kinase

Best hit in Arabidopsis

TAIR id	% identity	e-value	bit score	gene aliases	Short description
AT5G58380.1	64.44	3e-176	614	CIPK10;PKS2;SIP1;SNRK3.8	SOS3-interacting protein 1

>>>Show top 3 blast result

Query id	Subject id	alignment length	mis matches	gap openings	query start	query end	subject start	subject end	% identity	e-value	bit score
g293484	AT5G58380.1	450	143	3	6	440	4	451	64.44	3e-176	614
g293484	AT5G45820.1	441	128	7	4	438	2	425	65.76	3e-168	588
g293484	AT5G07070.1	444	154	4	6	445	4	444	63.74	5e-164	574

Ortholog group

Species	Genes
Allium cepa	g243453.t1; g252436.t1; g293484.t1; g413559.t1; g44186.t1
Allium fistulosum	AfisC1G06459; AfisC2G04121; AfisC3G06851; AfisC4G00331; AfisC7G00117
Allium sativum	Asa3G04746.1; Asa6G01761.1; Asa7G03029.1; Asa7G03041.1
Arabidopsis thaliana	AT5G45820.1; AT5G58380.1
Oryza sativa	LOC_Os01g10890.1; LOC_Os01g60910.1; LOC_Os01g60910.2; LOC_Os02g06570.1; LOC_Os02g06570.2; LOC_Os03g22050.1; LOC_Os03g22050.2; LOC_Os03g22050.3; LOC_Os03g22050.4; LOC_Os05g26820.1; LOC_Os07g48100.1; LOC_Os11g02240.1; LOC_Os12g02200.1; LOC_Os12g02200.2

Pfam domain

Pfam ID	Pfam name	type	alignment_start	alignment_end	bit_score	Evalue
PF00069.22	Pkinase	Domain	14	268	254.2	1.2e-75
PF03822.11	NAF	Domain	313	370	86.4	9.4e-25

Gene Ontology

Accession	Ontology	Name
GO:0005622	C	intracellular
GO:0005575	C	cellular_component
GO:0001101	P	response to acid chemical
GO:0008152	P	metabolic process
GO:0003674	F	molecular_function
GO:0003824	F	catalytic activity
GO:0004672	F	protein kinase activity
GO:0004674	F	protein serine/threonine kinase activity
GO:0007165	P	signal transduction
GO:0035556	P	intracellular signal transduction
GO:0005623	C	cell
GO:0006464	P	cellular protein modification process
GO:0006468	P	protein phosphorylation
GO:0006793	P	phosphorus metabolic process
GO:0006796	P	phosphate-containing compound metabolic process
GO:0006807	P	nitrogen compound metabolic process
GO:0007154	P	cell communication
GO:0008150	P	biological_process
GO:0009719	P	response to endogenous stimulus
GO:0009725	P	response to hormone
GO:0009737	P	response to abscisic acid
GO:0009738	P	abscisic acid-activated signaling pathway
GO:0009755	P	hormone-mediated signaling pathway
GO:0009787	P	regulation of abscisic acid-activated signaling pathway
GO:0009788	P	negative regulation of abscisic acid-activated signaling pathway
GO:0009966	P	regulation of signal transduction
GO:0009968	P	negative regulation of signal transduction
GO:0009987	P	cellular process
GO:0010033	P	response to organic substance
GO:0010646	P	regulation of cell communication
GO:0010648	P	negative regulation of cell communication
GO:0016301	F	kinase activity
GO:0016310	P	phosphorylation
GO:0016740	F	transferase activity
GO:0016772	F	transferase activity, transferring phosphorus-containing groups
GO:0016773	F	phosphotransferase activity, alcohol group as acceptor
GO:0018105	P	peptidyl-serine phosphorylation
GO:0018107	P	peptidyl-threonine phosphorylation
GO:0018193	P	peptidyl-amino acid modification
GO:0018209	P	peptidyl-serine modification
GO:0018210	P	peptidyl-threonine modification
GO:0019538	P	protein metabolic process
GO:0023052	P	signaling
GO:0070887	P	cellular response to chemical stimulus
GO:0023051	P	regulation of signaling
GO:0023057	P	negative regulation of signaling
GO:0032870	P	cellular response to hormone stimulus
GO:0033993	P	response to lipid
GO:0036211	P	protein modification process
GO:0042221	P	response to chemical
GO:0043170	P	macromolecule metabolic process
GO:0043412	P	macromolecule modification
GO:0044237	P	cellular metabolic process
GO:0044238	P	primary metabolic process
GO:0044260	P	cellular macromolecule metabolic process
GO:0044267	P	cellular protein metabolic process
GO:0044464	C	cell part
GO:0048519	P	negative regulation of biological process
GO:0048523	P	negative regulation of cellular process
GO:0048583	P	regulation of response to stimulus
GO:0048585	P	negative regulation of response to stimulus
GO:0050789	P	regulation of biological process
GO:0050794	P	regulation of cellular process
GO:0050896	P	response to stimulus
GO:0051716	P	cellular response to stimulus
GO:0065007	P	biological regulation
GO:0071215	P	cellular response to abscisic acid stimulus
GO:0071229	P	cellular response to acid chemical
GO:0071310	P	cellular response to organic substance
GO:0071396	P	cellular response to lipid
GO:0071495	P	cellular response to endogenous stimulus
GO:0071704	P	organic substance metabolic process
GO:0097305	P	response to alcohol
GO:0097306	P	cellular response to alcohol
GO:1901419	P	regulation of response to alcohol
GO:1901420	P	negative regulation of response to alcohol
GO:1901564	P	organonitrogen compound metabolic process
GO:1901700	P	response to oxygen-containing compound
GO:1901701	P	cellular response to oxygen-containing compound
GO:0140096
GO:1905957
GO:1905958

KEGG pathway

KO	Name	Enzyme ID	Pathway	Pathway ID
K07198	PRKAA, AMPK; 5'-AMP-activated protein kinase, catalytic alpha subunit	EC:2.7.11.11	Apelin signaling pathway	ko04371
			FoxO signaling pathway	ko04068
			PI3K-Akt signaling pathway	ko04151
			AMPK signaling pathway	ko04152
			mTOR signaling pathway	ko04150
			Autophagy - animal	ko04140
			Tight junction	ko04530
			Insulin signaling pathway	ko04910
			Glucagon signaling pathway	ko04922
			Adipocytokine signaling pathway	ko04920
			Oxytocin signaling pathway	ko04921
			Axon regeneration	ko04361
			Longevity regulating pathway	ko04211
			Longevity regulating pathway - multiple species	ko04213
			Circadian rhythm	ko04710
			Thermogenesis	ko04714
K12761	SNF1; carbon catabolite-derepressing protein kinase	EC:2.7.11.1	Autophagy - yeast	ko04138
K12761	SNF1; carbon catabolite-derepressing protein kinase	EC:2.7.11.1	Meiosis - yeast	ko04113

Expression pattern in different tissues

Expression pattern in BioProjects

Co-expression network