result

Gene information

Detail information of g357877

Location

Gene	Chr	Start	End	Strand
g357877	Scaffold_71586:HRSCAF_454672	840814	841831	-

Sequences

CDS

Protein

Gene

>g357877.t1
ATGGCTTTCACATCTCTTCCAATCTATCTTGATCCTTTGAATTGGAATCAGGTAAGCTATCCTTTTACTGTAATAAACACTCTTGAATATTCTTAAATCTGTTTAATTCCTTTTTCAGCCTAATCAGCAAACCCAAAACGCTGATCAGCAATCGCATATGTTCATATCTTCGACAACAAACAACAATGAATCGGCTCAAGAAACCCAAAACCCCAACAACACCTCCTCCATGGCCAAACCTGGGTCCATGGCGGAGCGGGCCCGTCTAGCCAAGATCCCTCAGCCCGAGCCCGCTTTAAAATGCCCTAGGTGCGATTCGACCAACACCAAGTTCTGCTACTTCAACAACTACTCCCTCTCCCAGCCACGTCACTTCTGCAAGACTTGCCGTCGCTACTGGACACGCGGTGGTGCCCTCCGCAGCGTCCCAGTAGGCGGCGGCTGTAGGCGCAACAAACGGGGCAGCAACAGCAAATCTTCTGCTAACAAATCGGGGGCCTCATCCTCAGTAGCTGTGTCTTCTTCTTCTAACTGCTCCACTGCCACTAGCGGCAGTGGGCTTTTGCCCTCGAATTTCTCCCAGTTTCCCCTTTTGAGCTCCTTACACCCTTTGACCGAGCAGTTAGGTTTCAATTTTTCGATGATGCAGCAGCAATCCATCGATGCTAACGAGTATCAGTTAGGTGGAAATATAAATGTACAACAGTTTCCATTTATGGATAATACATCGTTAATGAGTGGGATTAACTATGGTAATTTTCATGGAGAGGTCGGGAGCGATCATAATCAGTTAGGGTTTCATATGCCAATGAAAATTTCTAGTGGTGCTACTAATCTAGGGTTGATTACTCAAATGGCATCTGTGAAAATGGAGGATAGTCATGCACAAGGAATGAATTTATCGAGGCAATATCTTGGAATTTCGAGTAATGATCCATATATGAGCGGGTTATGGGATGGAAATGGAAATGGGAATGTTTCAGGATTTAATTCCACATCGGCTGGGAACTTACTGTGA

Functional annotation

Database	accession number	e-value	annotation
nr	XP_031287516.1	5.1e-49	dof zinc finger protein DOF2.2-like isoform X1
Swissprot	Q9M2U1.2	4.8e-36	OBF-binding protein 3
trEMBL	A0A8T2Y2B2	5.7e-50	Dof-type domain-containing protein

Best hit in Arabidopsis

TAIR id	% identity	e-value	bit score	gene aliases	Short description
AT5G02460.1	89.61	3e-40	162		Dof-type zinc finger DNA-binding family protein

>>>Show top 3 blast result

Query id	Subject id	alignment length	mis matches	gap openings	query start	query end	subject start	subject end	% identity	e-value	bit score
g357877	AT5G02460.1	77	8	0	55	131	73	149	89.61	3e-40	162
g357877	AT3G55370.2	145	51	4	1	139	1	139	56.55	8e-40	160
g357877	AT3G55370.1	145	51	4	1	139	1	139	56.55	1e-39	160

Ortholog group

Species	Genes
Allium cepa	g303432.t1; g357877.t1
Allium fistulosum	AfisC1G00432
Allium sativum	Asa7G00824.1; Asa7G00825.1
Arabidopsis thaliana	AT3G55370.1; AT3G55370.2; AT3G55370.3
Oryza sativa	LOC_Os07g13260.1

Pfam domain

Pfam ID	Pfam name	type	alignment_start	alignment_end	bit_score	Evalue
PF02701.12	zf-Dof	Family	76	131	110.7	2.4e-32

Gene Ontology

Accession	Ontology	Name
GO:0005622	C	intracellular
GO:0005575	C	cellular_component
GO:0001067	F	regulatory region nucleic acid binding
GO:0003674	F	molecular_function
GO:0003676	F	nucleic acid binding
GO:0003677	F	DNA binding
GO:0003700	F	transcription factor activity, sequence-specific DNA binding
GO:0005488	F	binding
GO:0005623	C	cell
GO:0005634	C	nucleus
GO:0043231	C	intracellular membrane-bounded organelle
GO:0006355	P	regulation of transcription, DNA-templated
GO:0008150	P	biological_process
GO:0009889	P	regulation of biosynthetic process
GO:0010468	P	regulation of gene expression
GO:0010556	P	regulation of macromolecule biosynthetic process
GO:0044212	F	transcription regulatory region DNA binding
GO:0019219	P	regulation of nucleobase-containing compound metabolic process
GO:0019222	P	regulation of metabolic process
GO:0031323	P	regulation of cellular metabolic process
GO:0031326	P	regulation of cellular biosynthetic process
GO:0043226	C	organelle
GO:0043227	C	membrane-bounded organelle
GO:0043229	C	intracellular organelle
GO:0043565	F	sequence-specific DNA binding
GO:0044424	C	intracellular part
GO:0044464	C	cell part
GO:0050789	P	regulation of biological process
GO:0050794	P	regulation of cellular process
GO:0051171	P	regulation of nitrogen compound metabolic process
GO:0051252	P	regulation of RNA metabolic process
GO:0060255	P	regulation of macromolecule metabolic process
GO:0065007	P	biological regulation
GO:0080090	P	regulation of primary metabolic process
GO:0097159	F	organic cyclic compound binding
GO:1901363	F	heterocyclic compound binding
GO:1903506	P	regulation of nucleic acid-templated transcription
GO:2000112	P	regulation of cellular macromolecule biosynthetic process
GO:2001141	P	regulation of RNA biosynthetic process
GO:0140110

KEGG pathway

KO	Name	Enzyme ID	Pathway	Pathway ID
-	-	-	-	-

Expression pattern in different tissues

Expression pattern in BioProjects

Co-expression network