result

Gene information

Detail information of g372477

Location

Gene	Chr	Start	End	Strand
g372477	Scaffold_73442:HRSCAF_456528	67120	69045	+

Sequences

CDS

>g372477.t1
ATGATGGGCATGCAGAAAAGTTATCTCCAAATTACTTATTCAGCAGAGATAGTCAATGGCGAACCCATATACAGTTCATCGAATGCCCTTCCATTTAAAGCATCGTACTTTGAACCAGCTGGTCATGCCTTTCATTTGGCTGCCCTTAAACTCTCAGGCCATGAAGAAAAGGAAGACACAGACACAGATGATCAAAGCATCATGTCAGACGACAAAGACCAAACTTACATGCCAACTTCAGATTCCTACGGCAGTAAACGCAAAAAGAAGTCAGCAGATGGAAGCAAACAACAAGATCATTATGCACTAATAGGGTTAGGGCATTTGCGTTTTTTAGCTACCGAGGATCAGATAAAAAAGTGCTACCGTGAAACTGCTTTAAAGCATCATCCTGACAAGCAAGCTGCTCTTCTTCTTACGGAAACAAATGAAGAAGCAAAGGTGAAAAAGAAGGAAGAAATAGAAAACCACTTCAAAGCCATTCAAGAAGCATACGAGGTACTAAGTGATCCAGCAAAAAGAAGAGTTTACGACTCAACAGATGAATTCGATGATGAAGTTCCTACTGATTGTGCACCTGAAGATTTCTTCAAGGTATTTGGTCCGGTGTTTATGAGAAATGGAAAATGGTCTGTGAATCAACCTGTGCCTTCTTTGGGAAATGAAAAGACTCTTTATAGTGAAGTGGATAGCTTTTACGATTTTTGGTACACGTTCAAAAGCTGGAGAGAGTTTCCACATGCTGATGAATTTGATCTTGAGGATGCAGAATCTCGTGATCATAAGAGATGGATGGAGAGGCAGAATGCAAAATTAAGAGAAAAGGCAAGAAAAGAAGAGCATACACGTGTTCGAAACCTTGTCGATAATGCTTACAAGAGAGATCCAAGGATACTGAGAAGGAAGGAAGAGGAGAAGGAAGAAAAAAAGCGGAAGAAGGAAGCAAAAATCATGGCTAAGAGGTTGCAAGAGGAAGAGGCGGCGAAAGCTGCCGAAGAAGAGAAGAGAGAGAAAGAAGAAGAAGAGAAGAGAGCAGCCGAAGCTGCTTTGATTCAGAAGAAGCAAAAGGAGAAGGAAAAGAAACTTCTACGGAAAGTAAGGACTCGCTTTCGTACACTGTCGAAGACATCTGCTTCTGCTATTTCAGAAGAAGATATAGAGGGTTTATGTATGTCGCTCGACCTTGTCAAGCTTCAATGCTTATGTGATGACATGGAAAACAAGGATGAAAGCACTAAAGTTCAACTTCTCAAAGGTGTTTTAAACAAAGAAAGCTCAAATGACAGTGTGAAACAAGATGAAGGGAAAATTTCAAAAGCAAACGGAGCTGTATCTGAAGTCAAGTTAAGCAATTATGAGAAGAAGGAAAAGCCATGGGGGAAGGAAGAAATAGAAATGCTAAGGAAGGGGATACAGAAGTATCCAAAGGGAACTTCTAGAAGATGGGAGGTGATTTCAGAGTATATTGGCACTGGGCGATCGGTTGAAGAGATTCTTAAAGCTACCAAAACCGTTCTGCTTAGAAAACCAGATTCTTCAAAGGCTTTTGATTCGTTTCTGGAGAAAAGAAAGCCTGCACCGACTATTGCTTCTCCACTTTCAACTAGGGAGGAACCCATAGGCATTTCAGCTACGCAAGAAACATCTTCTAAGCAGTCTGCTTCAACTAGTAATGTTAATACTCCGCCAGTAGCTGAACAAGCTTCTACAGTTAACACTGGAGTAGCTTCTTCAAGTAGTGAGCAGGATGCATGGTCATCTGTTCAAGAAAGAGCTCTTGTTCAAGCTCTTAAGACATTTCCAAAAGATGCTGCACAGCGTTGGGAAAGAGTTGCTGCTGCTGTTCCCGGAAAAACTGTTATTCAGTGCAAAAAGAAATTCGCAGCCATGAAGGAGAGTTTCAGGAACAAGAAAAATGCGGATTAG

Protein

Gene

Functional annotation

Database	accession number	e-value	annotation
nr	AMD40258.1	6.4e-217	gonidialess A related factor
Swissprot	Q6NWJ4.1	2.4e-59	DnaJ homolog subfamily C member 2
trEMBL	A0A125RM40	4.6e-217	Gonidialess A related factor

Best hit in Arabidopsis

TAIR id	% identity	e-value	bit score	gene aliases	Short description
AT3G11450.1	62.07	0.0	681		DnaJ domain ;Myb-like DNA-binding domain

>>>Show top 3 blast result

Query id	Subject id	alignment length	mis matches	gap openings	query start	query end	subject start	subject end	% identity	bit score
g372477	AT3G11450.1	638	230	5	11	640	13	646	62.07	681
g372477	AT5G06110.2	660	245	10	3	638	5	660	58.64	662
g372477	AT5G06110.1	660	245	10	3	638	5	660	58.64	662

Ortholog group

Species	Genes
Allium cepa	g303727.t1; g372477.t1
Allium fistulosum	AfisC5G06970; AfisC6G06422
Allium sativum	Asa4G04628.1; Asa8G00369.1; Asa8G00370.1
Arabidopsis thaliana	AT3G11450.1; AT5G06110.1; AT5G06110.2
Oryza sativa	LOC_Os04g30890.1

Pfam domain

Pfam ID	Pfam name	type	alignment_start	alignment_end	bit_score	Evalue
PF00226.28	DnaJ	Domain	99	178	64.0	9.1e-18
PF00249.28	Myb_DNA-binding	Domain	457	498	28.2	1.4e-06
PF00249.28	Myb_DNA-binding	Domain	584	627	26.4	5.3e-06

Gene Ontology

Accession	Ontology	Name
GO:0005515	F	protein binding
GO:0005622	C	intracellular
GO:0005575	C	cellular_component
GO:0001558	P	regulation of cell growth
GO:0003674	F	molecular_function
GO:0003682	F	chromatin binding
GO:0042393	F	histone binding
GO:0005829	C	cytosol
GO:0005488	F	binding
GO:0005623	C	cell
GO:0005634	C	nucleus
GO:0005737	C	cytoplasm
GO:0043231	C	intracellular membrane-bounded organelle
GO:0006355	P	regulation of transcription, DNA-templated
GO:0008150	P	biological_process
GO:0009889	P	regulation of biosynthetic process
GO:0009891	P	positive regulation of biosynthetic process
GO:0009893	P	positive regulation of metabolic process
GO:0010468	P	regulation of gene expression
GO:0010556	P	regulation of macromolecule biosynthetic process
GO:0010557	P	positive regulation of macromolecule biosynthetic process
GO:0010604	P	positive regulation of macromolecule metabolic process
GO:0010628	P	positive regulation of gene expression
GO:0045935	P	positive regulation of nucleobase-containing compound metabolic process
GO:0045893	P	positive regulation of transcription, DNA-templated
GO:0019219	P	regulation of nucleobase-containing compound metabolic process
GO:0019222	P	regulation of metabolic process
GO:0030308	P	negative regulation of cell growth
GO:0031323	P	regulation of cellular metabolic process
GO:0031325	P	positive regulation of cellular metabolic process
GO:0031326	P	regulation of cellular biosynthetic process
GO:0031328	P	positive regulation of cellular biosynthetic process
GO:0040008	P	regulation of growth
GO:0043226	C	organelle
GO:0043227	C	membrane-bounded organelle
GO:0043229	C	intracellular organelle
GO:0044424	C	intracellular part
GO:0044444	C	cytoplasmic part
GO:0044464	C	cell part
GO:0045926	P	negative regulation of growth
GO:0048518	P	positive regulation of biological process
GO:0048519	P	negative regulation of biological process
GO:0048522	P	positive regulation of cellular process
GO:0048523	P	negative regulation of cellular process
GO:0050789	P	regulation of biological process
GO:0050794	P	regulation of cellular process
GO:0051128	P	regulation of cellular component organization
GO:0051171	P	regulation of nitrogen compound metabolic process
GO:0051173	P	positive regulation of nitrogen compound metabolic process
GO:0051252	P	regulation of RNA metabolic process
GO:0051254	P	positive regulation of RNA metabolic process
GO:0060255	P	regulation of macromolecule metabolic process
GO:0061649	F	ubiquitinated histone binding
GO:0065007	P	biological regulation
GO:0080090	P	regulation of primary metabolic process
GO:1902680	P	positive regulation of RNA biosynthetic process
GO:1903506	P	regulation of nucleic acid-templated transcription
GO:1903508	P	positive regulation of nucleic acid-templated transcription
GO:2000112	P	regulation of cellular macromolecule biosynthetic process
GO:2001141	P	regulation of RNA biosynthetic process
GO:0140030
GO:0140035
GO:0140036

KEGG pathway

KO	Name	Enzyme ID	Pathway	Pathway ID
K09522	DNAJC2; DnaJ homolog subfamily C member 2	EC:-	-	-

Expression pattern in different tissues

Expression pattern in BioProjects

Co-expression network