result

Gene information

Detail information of g396097

Location

Gene	Chr	Start	End	Strand
g396097	Scaffold_76271:HRSCAF_459357	137512	139414	+

Sequences

CDS

Protein

Gene

>g396097.t1
ATGGCAATCGCTGCAGAGACTCAGTTTCATGTGTTAGCAGTAGATGATAGTATAATTGATAGAAAACTTATTGAAAGGCTTCTAAAAACCTCGTCATATCAAGGTAAAATTTACTTAATAATACCCATTCGATCTTTCTATTTTTTGTTCCTGTTTTTATTCTTGTTTGATTAATAATTTTTGTTTTGTAATCAGTTACAACTGTGGATTCTGGAAGCAAAGCTTTGCAATTTCTTGGCTTAATGAATGATTTGCAAGAAAACTCACCTTCCCCTTCTTCTTCTTCATCGTCTGAATATAATGTGAGAATAATTAAGCACTAATTTCAATTTCTGTATTTCATTTTTCTGATGTTAGAATTCGGGGTGTTGTTATAATTGTAGGAAATTGAGGTGAACATGGTGATTACAGATTACTGTATGCCTGGCATGACTGGATATGATTTACTAAAGAAAATCAAAGCAAGTTTACTTATTAAGCTTATCTGATTGTTTAATTGTTAAAAGAATTTTGTAGCTTGTTACAATGAAATTTAATTCTGTAATTAATTATTTTTATGCCTTGATCAGGAATCACAATCTCTGAAGGATATTCCTGTTGTTATCATGTCTTCTGAGAATGAGCCTTCAAGGATTAACAGGTTCGCAATTCTGCATTTATCTTGTTCATATTCTCGTTACTTGTAATATTGTTATAACTAATATTATTTTAGTTTGCAACATGATTTTAGACTTTGAGTAAGATTGAATAAACTCCTTACTGAAATAAATTGTTATTACTGTGCAAAATTTTGATTTTAAAGGAATGTAATGACTTATTTGACTGAGGACAGAGGCACGAAATGACTTGCTTGAGCATGGAATCTTCTCAACTCAGTGATAAGATAAAGAAAATACTGCAATATGAACCAGCATATAGTTGCAATCGAACACTAGCAAACTACTGATGTAAAATAGCGTTTAAAAAGGAGAAGTTTATTCATGCTAATTAATATGATGAGCTCAATTCCTCAACATTTACTAGACTTGACCTTTGTCATGACATTGACAGCATAGAATTTGACGGTGCTTTGCTGAATTTTGTTTTAATATTTAACAAATGGTAGAGTTTCATGAATTAAATGAGATAAAATTCAAATATACTGAAATCTCTATTAAGTAAAACACTTTTACAAAATTATAGAGTAGAGAAAGTTAGTTGGCCCTTGTGAACATTAGGTGGCATCAATATTTCTCTTGTTGATCAAATATTTCACTTATTATGTTTATTATTTTGTCTTGCAAAAACTTGTTTGAAAACGACTTGCAATTTTTTGAGCTATTTAAGTGTAAATTAGGAAGCAATTTCAGCGGCTTCACCAACGCATCTACTTTTTTACTCGAATACTACTCAAGATAATATGAATTTTTTTGTTAGTTTAACAGTATTAGCTAAAATAATATGCGGTGATCCTGTACATCATGATTTGAGAAGACAATATAAATAGCAATGTTCTTTGCAAGAGGGATAAAGTAAAAGAAAATTTCTTTATACCAAAACAAGTCAAAATCATTCCAAATCTTTTTTATTCTTCATGTAGATTTTATTCCTATCTCTTTTTTACGATGGGTCACCATAAAATGCACTCCTGAACATGGCAAATTTGGATTGATTGATTGAATGCAGATGCTTAGAAGAAGGAGCAGATGAATTTTTACTAAAACCAGTAAAATTAGCAGATGTGAACAAACTGAGACCTTTCATATTAAAAAGTAAGAATAAAGATGAAATTCAGGAAGAGCAAAACCAAACTCAGGCTGAAAGTCAAGCATGCAGTAAAAAAAGAAAACCAAGTGATGAAGGACTCTCACCTGAAAGGTCAAGGCCTAGACATTCAAGTAATAGTAGTTTGAACGTACTGTGA

Functional annotation

Database	accession number	e-value	annotation
nr	OVA13291.1	5.8e-60	Signal transduction response regulator
Swissprot	Q2RAP3.2	2.1e-54	Type A response regulator 9
trEMBL	A0A200QS60	4.2e-60	Signal transduction response regulator

Best hit in Arabidopsis

TAIR id	% identity	e-value	bit score	gene aliases	Short description
AT3G57040.1	51.77	1e-60	229	ARR9;ATRR4	response regulator 9

>>>Show top 3 blast result

Query id	Subject id	alignment length	mis matches	gap openings	query start	query end	subject start	subject end	% identity	e-value	bit score
g396097	AT3G57040.1	226	71	1	1	188	1	226	51.77	1e-60	229
g396097	AT2G41310.1	220	72	2	1	189	1	218	52.27	2e-58	222
g396097	AT1G59940.1	141	46	1	8	148	32	162	60.28	9e-47	182

Ortholog group

Species	Genes
Allium cepa	g218616.t1; g396097.t1; g479163.t1
Allium fistulosum	AfisC1G03842; AfisC1G03847; AfisC3G07005; AfisC5G02805; AfisC8G01453
Allium sativum	Asa1G03632.1; Asa4G04368.1; Asa7G05199.1; Asa7G05200.1
Arabidopsis thaliana	AT2G41310.1; AT3G57040.1
Oryza sativa	LOC_Os01g72330.1; LOC_Os11g04720.1; LOC_Os11g04720.2; LOC_Os12g04500.1

Pfam domain

Pfam ID	Pfam name	type	alignment_start	alignment_end	bit_score	Evalue
PF00072.21	Response_reg	Domain	11	139	75.4	3.3e-21

Gene Ontology

Accession	Ontology	Name
GO:0000156	F	phosphorelay response regulator activity
GO:0000160	P	phosphorelay signal transduction system
GO:0005622	C	intracellular
GO:0005575	C	cellular_component
GO:0003674	F	molecular_function
GO:0007165	P	signal transduction
GO:0035556	P	intracellular signal transduction
GO:0005623	C	cell
GO:0005634	C	nucleus
GO:0043231	C	intracellular membrane-bounded organelle
GO:0006355	P	regulation of transcription, DNA-templated
GO:0007154	P	cell communication
GO:0007623	P	circadian rhythm
GO:0008150	P	biological_process
GO:0009719	P	response to endogenous stimulus
GO:0009725	P	response to hormone
GO:0009735	P	response to cytokinin
GO:0009736	P	cytokinin-activated signaling pathway
GO:0009755	P	hormone-mediated signaling pathway
GO:0009889	P	regulation of biosynthetic process
GO:0009987	P	cellular process
GO:0010033	P	response to organic substance
GO:0010468	P	regulation of gene expression
GO:0010556	P	regulation of macromolecule biosynthetic process
GO:0019219	P	regulation of nucleobase-containing compound metabolic process
GO:0019222	P	regulation of metabolic process
GO:0023052	P	signaling
GO:0070887	P	cellular response to chemical stimulus
GO:0031323	P	regulation of cellular metabolic process
GO:0031326	P	regulation of cellular biosynthetic process
GO:0032870	P	cellular response to hormone stimulus
GO:0042221	P	response to chemical
GO:0043226	C	organelle
GO:0043227	C	membrane-bounded organelle
GO:0043229	C	intracellular organelle
GO:0044424	C	intracellular part
GO:0044464	C	cell part
GO:0048511	P	rhythmic process
GO:0050789	P	regulation of biological process
GO:0050794	P	regulation of cellular process
GO:0050896	P	response to stimulus
GO:0051171	P	regulation of nitrogen compound metabolic process
GO:0051252	P	regulation of RNA metabolic process
GO:0051716	P	cellular response to stimulus
GO:0060089	F	molecular transducer activity
GO:0060255	P	regulation of macromolecule metabolic process
GO:0065007	P	biological regulation
GO:0071310	P	cellular response to organic substance
GO:0071368	P	cellular response to cytokinin stimulus
GO:0071495	P	cellular response to endogenous stimulus
GO:0080090	P	regulation of primary metabolic process
GO:1903506	P	regulation of nucleic acid-templated transcription
GO:2000112	P	regulation of cellular macromolecule biosynthetic process
GO:2001141	P	regulation of RNA biosynthetic process

KEGG pathway

KO	Name	Enzyme ID	Pathway	Pathway ID
K14492	ARR-A; two-component response regulator ARR-A family	EC:-	Plant hormone signal transduction	ko04075

Expression pattern in different tissues

Expression pattern in BioProjects

Co-expression network