result

Gene information

Detail information of g451471

Location

Gene	Chr	Start	End	Strand
g451471	Scaffold_82466:HRSCAF_465552	538081	539880	+

Sequences

CDS

>g451471.t1
ATGGATACTTCATTCCTTAGTTTTCTTAATGGTAGTGAAGAAGATTATAACATGAGCAGCAACTATGATACCCGTAATGGAATTCCAAAATTTAAAACTATCACCCCTCCATCTCTTCCTATTTCAATTTCCTTATCATCTTATTTTGCTACTTTGTCTGGCCTCAGCCCCGCCGAGCTTTTACAATCCCCTATTCTTCTTACTTCCTTCAATAATGGCCTTCCATCTCCGACAACAGGAGCAATTCCATATGGATCGAACGATCCAAAGCCAAATCCTACAAATTACACAAACCCTCAACAAAGCATCAAAGAAGAAGAACATATTGCATTCAACGACTTTTCGTTCCAAATAACACATAGAAACAATACATATGAGCAGAGCAATGACTTAAATTATGAGGCAGAAACAACCAATATTCCTCAAATATTGAAAGAGCAAAAGGGTGCAAATGATGGATACAACTGGAGAAAATATGGACAGAAAGCAGTGAAAGGAAGCGAAAATCCAAGGAGCTATTACAAGTGCACTTTTCCAAATTGCCCAGTGAGGAAGAAAGTAGAGAGAAATGCGGATGGTCAAATTACTGAAATTATATATCGTGGAACTCATACTCATCCAAAGCCTCAACCTTCTAGAAGAAATTCAGGCACCTCTCATTTGATTATGAATAACCAAGCTCAACTTGAAGCATCTGGAACTTCTTTTAGTGCACTATCTGGCACACCTGAAAACTCTTCTGTTTCGTTTGTTGATGATGACGGTGATGTTGATGCAAGCTCTAAGAGGAGCAATTTGGGTGTAGATAGCATTGATGAAGGTGAACATAATGCTAAGAGAATAAAGCAAGAAGGCGATAATGAGAGAATAAATATAAACGGGACTCGAACAGTTAGAGAGCCTAAAGTGGTGGTTCAAACAACAAGTGATATCGATATACTTGACGATGGATATAGATGGAGGAAATATGGACAAAAGGTTGTGAAAGGAAACCCTAATCCAAGGAGCTACTACAAATGCACAAGTGGTGGCTGTGCTGTGCGAAAGCATGTAGAAAGAGCTTCGCATGATATAAGGGCTGTGATAACAACTTATGAAGGCAAACATAACCACGACGTGCCACAAGGTCGAGGCAGTGGTGCGGTCAATGGATCATCAACAATTAACAACGGTGCTATTATAAGACCTTCTGTTATTTCTAAACACCAGGATAATCAACCTCCTTTTACATTGGAAGTGCTTCAAGCTCCTGATAGTTATAACCATGGTTCTATATATTCTGGATATGGAAACTCAAACTATAACATGTATTCTAGAACCGGTAATGAACCAATAGGGGACTCTTTTGTGAATTCGTTGCTCCTTTGA

Protein

Gene

>g451471.t1
ATGGATACTTCATTCCTTAGTTTTCTTAATGGTAGTGAAGAAGATTATAACATGAGCAGCAACTATGATACCCGTAATGGAATTCCAAAATTTAAAACTATCACCCCTCCATCTCTTCCTATTTCAATTTCCTTATCATCTTATTTTGCTACTTTGTCTGGCCTCAGCCCCGCCGAGCTTTTACAATCCCCTATTCTTCTTACTTCCTTCAATAATGTAAGTAACTCAATTTTTTTAATCATATTTTGATGCTAATCATTTGATGACTAATTAGTTAAACTTAATTATATTGGTATTATTCTTATATGAATACACATGTAAAGATTTATGTTGGAATGGTTGCTAGTTTTATAATCATCCTATCTACATATTTAGAAGGAAAAGGAAAAATAGCTTACTTGGTTTTGTATATGTTAAGCAGGGCCTTCCATCTCCGACAACAGGAGCAATTCCATATGGATCGAACGATCCAAAGCCAAATCCTACAAATTACACAAACCCTCAACAAAGCATCAAAGAAGAAGAACATATTGCATTCAACGACTTTTCGTTCCAAATAACACATAGAAACAATACATATGAGCAGAGCAATGACTTAAATTATGAGGCAGAAACAACCAATATTCCTCAAATATTGAAAGAGCAAAAGGGTGCAAATGATGGATACAACTGGAGAAAATATGGACAGAAAGCAGTGAAAGGAAGCGAAAATCCAAGGAGCTATTACAAGTGCACTTTTCCAAATTGCCCAGTGAGGAAGAAAGTAGAGAGAAATGCGGATGGTCAAATTACTGAAATTATATATCGTGGAACTCATACTCATCCAAAGCCTCAACCTTCTAGAAGAAATTCAGGCACCTCTCATTTGATTATGAATAACCAAGCTCAACTTGAAGCATCTGGAACTTCTTTTAGTGCACTATCTGGCACACCTGAAAACTCTTCTGTTTCGTTTGTTGATGATGACGGTGATGTTGATGCAAGCTCTAAGAGGAGCAATTTGGGTGTAGATAGCATTGATGAAGGTGAACATAATGCTAAGAGAATGTAAGTGTTCAAACAATTCAATATTTTTTTTTACAAATGGTAGGGTTATATTTGATATCAAAATATAGAATGCATCTAAATATTGTTTGCTATGATTAATTCAGAAAGCAAGAAGGCGATAATGAGAGAATAAATATAAACGGGACTCGAACAGTTAGAGAGCCTAAAGTGGTGGTTCAAACAACAAGTGATATCGATATACTTGACGATGGATATAGATGGAGGAAATATGGACAAAAGGTTGTGAAAGGAAACCCTAATCCAAGGTTAGGAGCTCACCGAAGTTTTCATATAGAATTCACAAACGCAATACAACAGTTTTGTGCAATCTAACAAAGTTTCTTCAACAATTAGATACTGATAGGATTTAATATTTCTTGATTTCTCAGGAGCTACTACAAATGCACAAGTGGTGGCTGTGCTGTGCGAAAGCATGTAGAAAGAGCTTCGCATGATATAAGGGCTGTGATAACAACTTATGAAGGCAAACATAACCACGACGTGCCACAAGGTCGAGGCAGTGGTGCGGTCAATGGATCATCAACAATTAACAACGGTGCTATTATAAGACCTTCTGTTATTTCTAAACACCAGGATAATCAACCTCCTTTTACATTGGAAGTGCTTCAAGCTCCTGATAGTTATAACCATGGTTCTATATATTCTGGATATGGAAACTCAAACTATAACATGTATTCTAGAACCGGTAATGAACCAATAGGGGACTCTTTTGTGAATTCGTTGCTCCTTTGA

Functional annotation

Database	accession number	e-value	annotation
nr	XP_008809977.1	2.6e-111	WRKY transcription factor WRKY24-like
Swissprot	Q6IEQ7.1	1.0e-96	WRKY transcription factor WRKY24
trEMBL	A0A7S8F9L2	2.7e-123	Abiotic stress-related transcription factor

Best hit in Arabidopsis

TAIR id	% identity	e-value	bit score	gene aliases	Short description
AT2G38470.1	43.98	1e-84	310	ATWRKY33;WRKY33	WRKY DNA-binding protein 33

>>>Show top 3 blast result

Query id	Subject id	alignment length	mis matches	gap openings	query start	query end	subject start	subject end	% identity	e-value	bit score
g451471	AT2G38470.1	482	186	13	1	414	1	466	43.98	1e-84	310
g451471	AT4G26640.2	251	84	5	141	379	206	445	57.37	5e-73	271
g451471	AT5G07100.1	359	127	9	21	377	3	296	45.96	8e-73	271

Ortholog group

Species	Genes
Allium cepa	g145340.t1; g451471.t1
Allium fistulosum	AfisC3G06830; AfisC3G06833; AfisC3G07098
Allium sativum	Asa2G05606.1; Asa2G05607.1; Asa2G05608.1; Asa2G05609.1; Asa2G05888.1; Asa2G05889.1; Asa2G06099.1; Asa2G06100.1; Asa3G04989.1; Asa8G04341.1
Arabidopsis thaliana	AT5G07100.2
Oryza sativa	LOC_Os01g61080.1

Pfam domain

Pfam ID	Pfam name	type	alignment_start	alignment_end	bit_score	Evalue
PF03106.12	WRKY	Domain	151	207	90.6	5.2e-26
PF03106.12	WRKY	Domain	315	372	86.9	7.4e-25

Gene Ontology

Accession	Ontology	Name
GO:0005622	C	intracellular
GO:0005575	C	cellular_component
GO:0001067	F	regulatory region nucleic acid binding
GO:0001101	P	response to acid chemical
GO:0006790	P	sulfur compound metabolic process
GO:0008152	P	metabolic process
GO:0003674	F	molecular_function
GO:0003676	F	nucleic acid binding
GO:0003677	F	DNA binding
GO:0003700	F	transcription factor activity, sequence-specific DNA binding
GO:0006952	P	defense response
GO:0042742	P	defense response to bacterium
GO:0050832	P	defense response to fungus
GO:0005488	F	binding
GO:0005623	C	cell
GO:0005634	C	nucleus
GO:0043231	C	intracellular membrane-bounded organelle
GO:0006355	P	regulation of transcription, DNA-templated
GO:0006725	P	cellular aromatic compound metabolic process
GO:0006807	P	nitrogen compound metabolic process
GO:0006950	P	response to stress
GO:0006970	P	response to osmotic stress
GO:0008150	P	biological_process
GO:0009058	P	biosynthetic process
GO:0009266	P	response to temperature stimulus
GO:0042493	P	response to drug
GO:0009403	P	toxin biosynthetic process
GO:0009404	P	toxin metabolic process
GO:0009408	P	response to heat
GO:0009409	P	response to cold
GO:0009414	P	response to water deprivation
GO:0009415	P	response to water
GO:0009605	P	response to external stimulus
GO:0009607	P	response to biotic stimulus
GO:0051707	P	response to other organism
GO:0009617	P	response to bacterium
GO:0009620	P	response to fungus
GO:0009628	P	response to abiotic stimulus
GO:0009651	P	response to salt stress
GO:0009700	P	indole phytoalexin biosynthetic process
GO:0009719	P	response to endogenous stimulus
GO:0009725	P	response to hormone
GO:0009737	P	response to abscisic acid
GO:0009739	P	response to gibberellin
GO:0009787	P	regulation of abscisic acid-activated signaling pathway
GO:0009788	P	negative regulation of abscisic acid-activated signaling pathway
GO:0009889	P	regulation of biosynthetic process
GO:0009891	P	positive regulation of biosynthetic process
GO:0009893	P	positive regulation of metabolic process
GO:0009894	P	regulation of catabolic process
GO:0009896	P	positive regulation of catabolic process
GO:0009937	P	regulation of gibberellic acid mediated signaling pathway
GO:0009938	P	negative regulation of gibberellic acid mediated signaling pathway
GO:0009966	P	regulation of signal transduction
GO:0009968	P	negative regulation of signal transduction
GO:0009987	P	cellular process
GO:0010033	P	response to organic substance
GO:0010035	P	response to inorganic substance
GO:0010120	P	camalexin biosynthetic process
GO:0010200	P	response to chitin
GO:0010243	P	response to organonitrogen compound
GO:0010286	P	heat acclimation
GO:0010468	P	regulation of gene expression
GO:0010506	P	regulation of autophagy
GO:0010508	P	positive regulation of autophagy
GO:0010556	P	regulation of macromolecule biosynthetic process
GO:0010557	P	positive regulation of macromolecule biosynthetic process
GO:0010604	P	positive regulation of macromolecule metabolic process
GO:0010628	P	positive regulation of gene expression
GO:0010646	P	regulation of cell communication
GO:0010648	P	negative regulation of cell communication
GO:0044212	F	transcription regulatory region DNA binding
GO:0045935	P	positive regulation of nucleobase-containing compound metabolic process
GO:0045893	P	positive regulation of transcription, DNA-templated
GO:0018130	P	heterocycle biosynthetic process
GO:0019219	P	regulation of nucleobase-containing compound metabolic process
GO:0019222	P	regulation of metabolic process
GO:0019438	P	aromatic compound biosynthetic process
GO:0019748	P	secondary metabolic process
GO:0033554	P	cellular response to stress
GO:0023051	P	regulation of signaling
GO:0023057	P	negative regulation of signaling
GO:0031323	P	regulation of cellular metabolic process
GO:0031325	P	positive regulation of cellular metabolic process
GO:0031326	P	regulation of cellular biosynthetic process
GO:0031328	P	positive regulation of cellular biosynthetic process
GO:0031329	P	regulation of cellular catabolic process
GO:0031331	P	positive regulation of cellular catabolic process
GO:0033993	P	response to lipid
GO:0034605	P	cellular response to heat
GO:0034641	P	cellular nitrogen compound metabolic process
GO:0042221	P	response to chemical
GO:0042430	P	indole-containing compound metabolic process
GO:0042435	P	indole-containing compound biosynthetic process
GO:0043207	P	response to external biotic stimulus
GO:0043226	C	organelle
GO:0043227	C	membrane-bounded organelle
GO:0043229	C	intracellular organelle
GO:0043565	F	sequence-specific DNA binding
GO:0044237	P	cellular metabolic process
GO:0044249	P	cellular biosynthetic process
GO:0044271	P	cellular nitrogen compound biosynthetic process
GO:0044272	P	sulfur compound biosynthetic process
GO:0044424	C	intracellular part
GO:0044464	C	cell part
GO:0044550	P	secondary metabolite biosynthetic process
GO:0046217	P	indole phytoalexin metabolic process
GO:0046483	P	heterocycle metabolic process
GO:0048518	P	positive regulation of biological process
GO:0048519	P	negative regulation of biological process
GO:0048522	P	positive regulation of cellular process
GO:0048523	P	negative regulation of cellular process
GO:0048583	P	regulation of response to stimulus
GO:0048585	P	negative regulation of response to stimulus
GO:0050789	P	regulation of biological process
GO:0050794	P	regulation of cellular process
GO:0050896	P	response to stimulus
GO:0051171	P	regulation of nitrogen compound metabolic process
GO:0051173	P	positive regulation of nitrogen compound metabolic process
GO:0051252	P	regulation of RNA metabolic process
GO:0051254	P	positive regulation of RNA metabolic process
GO:0051704	P	multi-organism process
GO:0051716	P	cellular response to stimulus
GO:0052314	P	phytoalexin metabolic process
GO:0052315	P	phytoalexin biosynthetic process
GO:0052317	P	camalexin metabolic process
GO:0060255	P	regulation of macromolecule metabolic process
GO:0065007	P	biological regulation
GO:0070370	P	cellular heat acclimation
GO:0071704	P	organic substance metabolic process
GO:0080090	P	regulation of primary metabolic process
GO:0097159	F	organic cyclic compound binding
GO:0097305	P	response to alcohol
GO:0098542	P	defense response to other organism
GO:1901360	P	organic cyclic compound metabolic process
GO:1901362	P	organic cyclic compound biosynthetic process
GO:1901363	F	heterocyclic compound binding
GO:1901419	P	regulation of response to alcohol
GO:1901420	P	negative regulation of response to alcohol
GO:1901564	P	organonitrogen compound metabolic process
GO:1901566	P	organonitrogen compound biosynthetic process
GO:1901576	P	organic substance biosynthetic process
GO:1901698	P	response to nitrogen compound
GO:1901700	P	response to oxygen-containing compound
GO:1902680	P	positive regulation of RNA biosynthetic process
GO:1903506	P	regulation of nucleic acid-templated transcription
GO:1903508	P	positive regulation of nucleic acid-templated transcription
GO:2000112	P	regulation of cellular macromolecule biosynthetic process
GO:2001141	P	regulation of RNA biosynthetic process
GO:0140110
GO:1905957
GO:1905958

KEGG pathway

KO	Name	Enzyme ID	Pathway	Pathway ID
K13423	WRKY25; WRKY transcription factor 25	EC:-	MAPK signaling pathway - plant	ko04016
K13423	WRKY25; WRKY transcription factor 25	EC:-	Plant-pathogen interaction	ko04626
K13424	WRKY33; WRKY transcription factor 33	EC:-	MAPK signaling pathway - plant	ko04016
K13424	WRKY33; WRKY transcription factor 33	EC:-	Plant-pathogen interaction	ko04626

Expression pattern in different tissues

Expression pattern in BioProjects

Co-expression network