result

Gene information

Detail information of g455484

Location

Gene	Chr	Start	End	Strand
g455484	Scaffold_82894:HRSCAF_465980	2300	3866	-

Sequences

CDS

Protein

Gene

>g455484.t1
ATGATGGGCACTAAAGGGTTGACACTCTACCATCTCAAGAGTCATCTTCAGGTGATTTTCCCTTTCCAATTTTCACATTATCTTCCACTTTCTTTTACTTTATAATTATACTAATTTTGAGCTATAACCTTTTTTGGGGTTCCTTTTTTACTGCAGAAATATAGACTTGGAAAGCAATCACCTAAAGATACAGGACCTGAACCTAGTAGAAAAGGTAACTAGTTATTATCACAGTTTTCTAATAGAAGAGAAATATGTACCAGTGGTACATGCAATTTATAAATTATCAAAAAGACTATAATGTAAATAAGAAATCTGCATCACAAGTACAGATTCCTATAACTCTTGTACCAATGCGTTTGATTGTTTAAAATACAGGGAGTTCCAGTGGATATACATCTGCCATTACCGCAAGTGTTTCTCGAGTTAACTGTGCTGGGTAGGTTTCCTTATGAATGGATTATATGATCAAAATATTTAGTATTTACCATGAGAGTGAAAATACATACCCTTTTCTATTACTTTACAGTGAACTGCCACCATCAGAGACTTTGAAATATCAAATAGAGGTGCAAAAGAAGCTACAAGAACAACTTGAAGTAAGTCTTTTATAATTTTTATTACAATACTAGCAACGAAAATGATCATTCTACAGGACAAAACTGACTGCTAATCATATAAACCTTTCTCAGGTACCTTTAATAAATGTTCACCATCATTGTTGTATAGTGCCTTGATATTGTTTCTATATTTTCTCATGTTCATTTTAGCTTAAAAGAACTTAGCATTTGAATCAGCTTCATGTAGCCATGTAATTTTAGATTTCTGCTTGACCTCTACATATTTTTCAAACATTTTTTGCTTCAGTATACATCCTGCATTCATCATTGCCTCATAAAGTAGAGGATTTTATGGGTCATTATCTGCATCAACTAACTTCTGATTGAAACTTGTTTCGAAGTCTACCAAGTTTTCTCTGTCTTTATGTCTAGTCTTATTCCACAGTTTTAAGTTTTGTTTAATTCTTATGAGCTTTATCATAAATTTCTGAATTGGTGAACCCCATGTGAATTCTGATAAAAATTGTAACTACTTGATCTAAATAGCCACTTGATAGATGCCAATTGTTATTATATCTGAAAGGTGTGCCCCTTTAAGTTGAGGAAGTTTAGCAGTCTGATGGCCGATGATTGGATGGAGTTGACAGAACTGTTGTAGCAGCAGATGGGGGATGAAATTGTGGTTGTGGTGATGTTTTATTGGAGATAGTTCTGCTGTGAATTGAAGATGGTGGTTCTGGTGGTGGAGGATGCTGCTGTGGATGTTGTGGTTTTGAAGTTGAACTGAAAGTAGCAGTGGTATTGTGATTGTGATGAACTGCTGTATTGGTTGATGAACTGCTGCAGTGGAGTTGATGGTCTGATTGGTAATAGAAGTGGTGAATTTTGGTTTGTGGAGAAGCTTGACAGTGTGTGATGAGGTACAGGCAGCAGTAGGTGGATATGGTAAGAGCAGTTGTGATCGAATATTGGCAGAGGATGGTGGTCAAAATGGTGCAGTGTGGTAG

Functional annotation

Database	accession number	e-value	annotation
nr	XP_010918102.1	2.3e-14	myb family transcription factor PHL11
Swissprot	Q9SAK5.2	7.8e-07	Protein WOODY
trEMBL	A0A6I9QZV9	1.7e-14	myb family transcription factor PHL11

Best hit in Arabidopsis

TAIR id	% identity	e-value	bit score	gene aliases	Short description
AT1G79430.1	39.67	3e-13	70.5	APL;WDY	Homeodomain-like superfamily protein

>>>Show top 3 blast result

Query id	Subject id	alignment length	mis matches	gap openings	query start	query end	subject start	subject end	% identity	e-value	bit score
g455484	AT1G79430.1	121	59	4	1	121	3	109	39.67	3e-13	70.5
g455484	AT1G79430.2	121	59	4	1	121	68	174	39.67	4e-13	70.1
g455484	AT5G45580.1	93	43	3	1	82	41	133	41.94	4e-13	69.7

Ortholog group

Species	Genes
Allium cepa	g38449.t1; g425412.t1; g455484.t1
Allium fistulosum	AfisC5G05389
Allium sativum	Asa0G03351.1
Arabidopsis thaliana	AT5G45580.1
Oryza sativa	LOC_Os02g47190.1; LOC_Os04g51130.1

Pfam domain

Pfam ID	Pfam name	type	alignment_start	alignment_end	bit_score	Evalue
PF14379.3	Myb_CC_LHEQLE	Family	62	82	30.9	1.5e-07

Gene Ontology

Accession	Ontology	Name
GO:0005622	C	intracellular
GO:0005575	C	cellular_component
GO:0003674	F	molecular_function
GO:0003700	F	transcription factor activity, sequence-specific DNA binding
GO:0005623	C	cell
GO:0005634	C	nucleus
GO:0043231	C	intracellular membrane-bounded organelle
GO:0006355	P	regulation of transcription, DNA-templated
GO:0009888	P	tissue development
GO:0008150	P	biological_process
GO:0009889	P	regulation of biosynthetic process
GO:0009891	P	positive regulation of biosynthetic process
GO:0009893	P	positive regulation of metabolic process
GO:0010087	P	phloem or xylem histogenesis
GO:0010088	P	phloem development
GO:0010089	P	xylem development
GO:0010468	P	regulation of gene expression
GO:0010556	P	regulation of macromolecule biosynthetic process
GO:0010557	P	positive regulation of macromolecule biosynthetic process
GO:0010604	P	positive regulation of macromolecule metabolic process
GO:0010628	P	positive regulation of gene expression
GO:0045935	P	positive regulation of nucleobase-containing compound metabolic process
GO:0045893	P	positive regulation of transcription, DNA-templated
GO:0019219	P	regulation of nucleobase-containing compound metabolic process
GO:0019222	P	regulation of metabolic process
GO:0031323	P	regulation of cellular metabolic process
GO:0031325	P	positive regulation of cellular metabolic process
GO:0031326	P	regulation of cellular biosynthetic process
GO:0031328	P	positive regulation of cellular biosynthetic process
GO:0032502	P	developmental process
GO:0043226	C	organelle
GO:0043227	C	membrane-bounded organelle
GO:0043229	C	intracellular organelle
GO:0044424	C	intracellular part
GO:0044464	C	cell part
GO:0048518	P	positive regulation of biological process
GO:0048522	P	positive regulation of cellular process
GO:0048856	P	anatomical structure development
GO:0050789	P	regulation of biological process
GO:0050794	P	regulation of cellular process
GO:0051171	P	regulation of nitrogen compound metabolic process
GO:0051173	P	positive regulation of nitrogen compound metabolic process
GO:0051252	P	regulation of RNA metabolic process
GO:0051254	P	positive regulation of RNA metabolic process
GO:0060255	P	regulation of macromolecule metabolic process
GO:0065007	P	biological regulation
GO:0080090	P	regulation of primary metabolic process
GO:1902680	P	positive regulation of RNA biosynthetic process
GO:1903506	P	regulation of nucleic acid-templated transcription
GO:1903508	P	positive regulation of nucleic acid-templated transcription
GO:2000112	P	regulation of cellular macromolecule biosynthetic process
GO:2001141	P	regulation of RNA biosynthetic process
GO:0140110

KEGG pathway

KO	Name	Enzyme ID	Pathway	Pathway ID
-	-	-	-	-

Expression pattern in different tissues

Expression pattern in BioProjects

Co-expression network