result

Gene information

Detail information of g536236

Location

Gene	Chr	Start	End	Strand
g536236	Scaffold_92348:HRSCAF_475434	289048	290096	+

Sequences

CDS

Protein

Gene

>g536236.t1
ATGGCGGGCTTCACTCTAGGCGGCAGAAGCGGCGATCAAGAAGAAGACCCGAATTTATTCATTTACTCTTCTAATAATTCTGGAAACCCTAGAGGTTTTGAGCTATGGCAACAGCATCAGCAAATATCAAGGCAGCCTCGACAGTTTTACTCTTCCAACCCTACCATGCTTGCCTTTTCCGATATAAACCAGCATAATTTAGCTGGGTCTGGGAGTGGCACGGTTGTAAATAGAAGGGGAAGCTCGTCTGGAAGTGGTGGGATGAGCTGCCAAGACTGTGGTAATCAGGCTAAAAAAGACTGTGCATATATGCGGTGTAGGACATGCTGTAAGAGTAGAGGATTTCAGTGCCCTACGCACGTTAAGAGCACTTGGGTTCCAGTTGCTACACGGCGTGAACGTCAGCAGCAACTTGCTGCTGGCATTTCAATTGGTCGACAACAGCAACAGCAACAGCAAGCACAGACGCAACAACATCGAGAATTGCCGAAAAGATCACGTGAAATTACTACCATACTTCCCTTAACAACTACTTCTTCGGGTAATTCTCATAGATTAGTGATTTTTTTTTTCCATGAATCTTTTTTTATGTGCATTAAAAATTGAGGGTATTAAGTTATAATAAAATTAAGAAATTGCCACGAGCAAATTGAGTTTTGAATCATCAAATTCCATGTTTGGTAAAATCTTAACTGACTTAGAATTTATGACTAGCAGGAATGGAAGTGAGATACCCATCAGAGATAAACTCAACAGCAGTGTTCAGATGTGTGCGAGTGAGCCAAATGGACGAAGGAGAAGAAGAATATGCATACCAGACTGCAGTAAATATAGGAGGGCATTTGTTCCGAGGAATACTGTATGATCAAGGTCCGGAACAGTTTCATGTAGAATCATCATCTGCTGCTGCAATTACTGATTCTAGTAGGAACGTAGCGGGTTCGGGTGCAATGGAGGATCTGGATAATTCGGCCTATCCGACTGCGTTTAATGCATTTATAGAGGGTACACAGATTTTTTCCCATCATCATCATCATCGAAGACCTTAA

Functional annotation

Database	accession number	e-value	annotation
nr	XP_022894528.1	4.2e-51	protein SHI RELATED SEQUENCE 1-like
Swissprot	Q9XGX0.1	1.7e-41	Protein SHORT INTERNODES
trEMBL	A0A8T3AT82	7.2e-53	Protein SHI RELATED SEQUENCE 1

Best hit in Arabidopsis

TAIR id	% identity	e-value	bit score	gene aliases	Short description
AT5G66350.1	48.36	3e-51	199	SHI	Lateral root primordium (LRP) protein-related

>>>Show top 3 blast result

Query id	Subject id	alignment length	mis matches	gap openings	query start	query end	subject start	subject end	% identity	e-value	bit score
g536236	AT5G66350.1	213	87	5	90	283	120	328	48.36	3e-51	199
g536236	AT3G51060.1	309	103	11	33	281	69	365	43.37	2e-50	196
g536236	AT1G75520.1	362	124	14	1	282	1	342	38.12	8e-50	194

Ortholog group

Species	Genes
Allium cepa	g293173.t1; g536236.t1
Allium fistulosum	AfisC4G03417; AfisC8G02960
Allium sativum	Asa1G02309.1; Asa4G02652.1; Asa4G02653.1; Asa6G03909.1; Asa7G00326.1
Arabidopsis thaliana	AT1G19790.1; AT1G19790.2; AT1G75520.1; AT2G18120.1; AT2G21400.1; AT3G51060.1; AT4G36260.1; AT5G33210.1; AT5G33210.2; AT5G66350.1
Oryza sativa	LOC_Os06g49830.1; LOC_Os08g43410.1; LOC_Os09g36160.1

Pfam domain

Pfam ID	Pfam name	type	alignment_start	alignment_end	bit_score	Evalue
PF05142.9	DUF702	Family	87	234	216.8	1.5e-64

Gene Ontology

Accession	Ontology	Name
GO:0000003	P	reproduction
GO:0005515	F	protein binding
GO:0005622	C	intracellular
GO:0005575	C	cellular_component
GO:0001101	P	response to acid chemical
GO:0003006	P	developmental process involved in reproduction
GO:0003674	F	molecular_function
GO:0003676	F	nucleic acid binding
GO:0003677	F	DNA binding
GO:0003700	F	transcription factor activity, sequence-specific DNA binding
GO:0007165	P	signal transduction
GO:0005488	F	binding
GO:0005623	C	cell
GO:0005634	C	nucleus
GO:0043231	C	intracellular membrane-bounded organelle
GO:0006355	P	regulation of transcription, DNA-templated
GO:0007154	P	cell communication
GO:0046983	F	protein dimerization activity
GO:0007275	P	multicellular organism development
GO:0008150	P	biological_process
GO:0009555	P	pollen development
GO:0009719	P	response to endogenous stimulus
GO:0009725	P	response to hormone
GO:0009739	P	response to gibberellin
GO:0009740	P	gibberellic acid mediated signaling pathway
GO:0009755	P	hormone-mediated signaling pathway
GO:0009791	P	post-embryonic development
GO:0009889	P	regulation of biosynthetic process
GO:0009891	P	positive regulation of biosynthetic process
GO:0009893	P	positive regulation of metabolic process
GO:0009908	P	flower development
GO:0009937	P	regulation of gibberellic acid mediated signaling pathway
GO:0009938	P	negative regulation of gibberellic acid mediated signaling pathway
GO:0009966	P	regulation of signal transduction
GO:0009968	P	negative regulation of signal transduction
GO:0009987	P	cellular process
GO:0010033	P	response to organic substance
GO:0010468	P	regulation of gene expression
GO:0010476	P	gibberellin mediated signaling pathway
GO:0010556	P	regulation of macromolecule biosynthetic process
GO:0010557	P	positive regulation of macromolecule biosynthetic process
GO:0010604	P	positive regulation of macromolecule metabolic process
GO:0010628	P	positive regulation of gene expression
GO:0010646	P	regulation of cell communication
GO:0010648	P	negative regulation of cell communication
GO:0045935	P	positive regulation of nucleobase-containing compound metabolic process
GO:0045893	P	positive regulation of transcription, DNA-templated
GO:0019219	P	regulation of nucleobase-containing compound metabolic process
GO:0019222	P	regulation of metabolic process
GO:0022414	P	reproductive process
GO:0023052	P	signaling
GO:0070887	P	cellular response to chemical stimulus
GO:0023051	P	regulation of signaling
GO:0023057	P	negative regulation of signaling
GO:0031323	P	regulation of cellular metabolic process
GO:0031325	P	positive regulation of cellular metabolic process
GO:0031326	P	regulation of cellular biosynthetic process
GO:0031328	P	positive regulation of cellular biosynthetic process
GO:0032501	P	multicellular organismal process
GO:0032502	P	developmental process
GO:0032870	P	cellular response to hormone stimulus
GO:0033993	P	response to lipid
GO:0042221	P	response to chemical
GO:0043226	C	organelle
GO:0043227	C	membrane-bounded organelle
GO:0043229	C	intracellular organelle
GO:0044424	C	intracellular part
GO:0044464	C	cell part
GO:0046982	F	protein heterodimerization activity
GO:0048229	P	gametophyte development
GO:0048367	P	shoot system development
GO:0048437	P	floral organ development
GO:0048438	P	floral whorl development
GO:0048443	P	stamen development
GO:0048466	P	androecium development
GO:0048518	P	positive regulation of biological process
GO:0048519	P	negative regulation of biological process
GO:0048522	P	positive regulation of cellular process
GO:0048523	P	negative regulation of cellular process
GO:0048583	P	regulation of response to stimulus
GO:0048585	P	negative regulation of response to stimulus
GO:0048608	P	reproductive structure development
GO:0048653	P	anther development
GO:0048731	P	system development
GO:0048827	P	phyllome development
GO:0048856	P	anatomical structure development
GO:0050789	P	regulation of biological process
GO:0050794	P	regulation of cellular process
GO:0050896	P	response to stimulus
GO:0051171	P	regulation of nitrogen compound metabolic process
GO:0051173	P	positive regulation of nitrogen compound metabolic process
GO:0051252	P	regulation of RNA metabolic process
GO:0051254	P	positive regulation of RNA metabolic process
GO:0051716	P	cellular response to stimulus
GO:0060255	P	regulation of macromolecule metabolic process
GO:0061458	P	reproductive system development
GO:0065007	P	biological regulation
GO:0071229	P	cellular response to acid chemical
GO:0071310	P	cellular response to organic substance
GO:0071370	P	cellular response to gibberellin stimulus
GO:0071396	P	cellular response to lipid
GO:0071495	P	cellular response to endogenous stimulus
GO:0080090	P	regulation of primary metabolic process
GO:0090567	P	reproductive shoot system development
GO:0097159	F	organic cyclic compound binding
GO:0099402	P	plant organ development
GO:1901363	F	heterocyclic compound binding
GO:1901700	P	response to oxygen-containing compound
GO:1901701	P	cellular response to oxygen-containing compound
GO:1902680	P	positive regulation of RNA biosynthetic process
GO:1903506	P	regulation of nucleic acid-templated transcription
GO:1903508	P	positive regulation of nucleic acid-templated transcription
GO:2000112	P	regulation of cellular macromolecule biosynthetic process
GO:2001141	P	regulation of RNA biosynthetic process
GO:0140110

KEGG pathway

KO	Name	Enzyme ID	Pathway	Pathway ID
-	-	-	-	-

Expression pattern in different tissues

Expression pattern in BioProjects

Co-expression network