result

Gene information

Detail information of g83284

Location

Gene	Chr	Start	End	Strand
g83284	Scaffold_36030:HRSCAF_367078	184870	186108	+

Sequences

CDS

>g83284.t1
ATGCCCTTTAATCAACCATTTCAAGTCCTAGATTCAACAAATTATTGGGGCAGCGATATTGACTGCAAGAAAAGGAAAAACGTAATCTTCGAACCAAACTCAGTTCTTGACCATAAAAGAAGCAGAATAAGCACAAGCCCATCTGCATCTTCATCAACGCTGTCTACTTCTCTAGGCAGCACCGACCCCGCCACCGCCTCGCCCGAGGTCGGTGGGACCAACCTGGATGAGAAATGCACCATTGGCGGGCCCCGCTTGGATGATTTAGAAGCCATGCTTTCTGATTCAAGTGGGCATGACCAGAGTTTTCTACACTGGATTAGTGGTGGTGTTGGTACTGGTACCAATGTACAAGATCATGATGGAGATGGATCGACTTTTGGGTTAATGGATAATCCATATAGCACCGAACCAATTGGAGCTCCGTTACATCTACCAAACCCTTTGTTCTCACAAGAAGCCATGGAAGAGAAATCACTTGATTTCAATCAAAATATAATGTTCCCAAATCAAAATCCTTCCTTTTTGCTTCCAGTGCCTCAGTTTACCAATCAACTCCAAACCCATTTCGTAGATTCTGCTAATTATGCTCCTACTGCTAACACTAGTAGCTTGTTTCTTCGAAGAAATCAGCTTCAAAATCCAAGCTTTATGAACCATAATGCGGTTTCTTTGAATACAAGCGATGATTTAGCTGGTCAGTTGTTCAAGGCTGCTGAATTCATCGAATCTAGAAATATTATAGGCGCCCGTGAGATATTGGCGCGGCTCAATCAATGCTTCCCTTCTCAACCTATCATAGGAAAGCCTCTATTTCGCTCCTCCTTTTATTTCATGGAGGCTCTTCGTCTTATCATCAACAACTCTCTTCCTAATATGACCTTATCTACCCCATTTAATGTTCTTCTAAAGCTTGGAACTTACAAATCCTTTACCGACATCTCCCCTATTGTACAATTCACAAGCTTTACATCAATTCAAGCGATACTTGAAGAAACAAATGGCCATAGCAACATTCATATTATTGATTTTGATGTTGGGTTTGGTGGACATTGGTCTTCTTTTATGCAAGAACTAGCTCATAGTCGAGGAGGAGGTAATTGTTCTCTCAAAATTACGGTTTTTGCCTCCAATTCATCACATCATCCTCTCTCGAGCTTCATCTCACCAAAGAAAACCTCTTCTCATTTTGCGGCTGAGCTCAAACATCTCATTCGAATTCAACGTGCTAGGTCTTGA

Protein

Gene

Functional annotation

Database	accession number	e-value	annotation
nr	ONK59017.1	8.0e-80	uncharacterized protein A4U43_C08F2120
Swissprot	O81316.1	4.6e-32	SCL6-IV
trEMBL	A0A6I9S0E2	2.9e-47	scarecrow-like protein 27

Best hit in Arabidopsis

TAIR id	% identity	e-value	bit score	gene aliases	Short description
AT4G00150.1	41.23	7e-35	145	ATHAM3;HAM3;LOM3;SCL6-IV	GRAS family transcription factor

>>>Show top 3 blast result

Query id	Subject id	alignment length	mis matches	gap openings	query start	query end	subject start	subject end	% identity	e-value	bit score
g83284	AT4G00150.1	228	113	7	182	408	168	375	41.23	7e-35	145
g83284	AT2G45160.1	156	69	5	234	376	271	424	46.15	1e-24	111
g83284	AT3G60630.1	330	178	14	76	380	96	404	32.12	1e-19	94.7

Ortholog group

Species	Genes
Allium cepa	g503092.t1; g83284.t1; g83285.t1
Allium fistulosum	AfisC2G05615; AfisC3G06463
Allium sativum	Asa2G05422.1; Asa2G05423.1; Asa6G02657.1; Asa7G03967.1
Arabidopsis thaliana	AT4G00150.1
Oryza sativa	LOC_Os02g44360.1; LOC_Os02g44370.1; LOC_Os04g46860.1; LOC_Os06g01620.1

Pfam domain

Pfam ID	Pfam name	type	alignment_start	alignment_end	bit_score	Evalue
PF03514.11	GRAS	Family	233	383	113.0	1.3e-32

Gene Ontology

Accession	Ontology	Name
GO:0005622	C	intracellular
GO:0005575	C	cellular_component
GO:0000902	P	cell morphogenesis
GO:0000904	P	cell morphogenesis involved in differentiation
GO:0016049	P	cell growth
GO:0003674	F	molecular_function
GO:0003676	F	nucleic acid binding
GO:0003677	F	DNA binding
GO:0003700	F	transcription factor activity, sequence-specific DNA binding
GO:0005488	F	binding
GO:0005623	C	cell
GO:0005634	C	nucleus
GO:0043231	C	intracellular membrane-bounded organelle
GO:0006355	P	regulation of transcription, DNA-templated
GO:0040007	P	growth
GO:0007275	P	multicellular organism development
GO:0009653	P	anatomical structure morphogenesis
GO:0009888	P	tissue development
GO:0007623	P	circadian rhythm
GO:0008150	P	biological_process
GO:0009826	P	unidimensional cell growth
GO:0009889	P	regulation of biosynthetic process
GO:0009932	P	cell tip growth
GO:0009987	P	cellular process
GO:0010015	P	root morphogenesis
GO:0010053	P	root epidermal cell differentiation
GO:0010054	P	trichoblast differentiation
GO:0010468	P	regulation of gene expression
GO:0010556	P	regulation of macromolecule biosynthetic process
GO:0016043	P	cellular component organization
GO:0019219	P	regulation of nucleobase-containing compound metabolic process
GO:0019222	P	regulation of metabolic process
GO:0021700	P	developmental maturation
GO:0022622	P	root system development
GO:0030154	P	cell differentiation
GO:0031323	P	regulation of cellular metabolic process
GO:0031326	P	regulation of cellular biosynthetic process
GO:0032501	P	multicellular organismal process
GO:0032502	P	developmental process
GO:0032989	P	cellular component morphogenesis
GO:0043226	C	organelle
GO:0043227	C	membrane-bounded organelle
GO:0043229	C	intracellular organelle
GO:0043565	F	sequence-specific DNA binding
GO:0044424	C	intracellular part
GO:0044464	C	cell part
GO:0048364	P	root development
GO:0048468	P	cell development
GO:0048469	P	cell maturation
GO:0048511	P	rhythmic process
GO:0048588	P	developmental cell growth
GO:0048589	P	developmental growth
GO:0048731	P	system development
GO:0048764	P	trichoblast maturation
GO:0048765	P	root hair cell differentiation
GO:0048767	P	root hair elongation
GO:0048768	P	root hair cell tip growth
GO:0048856	P	anatomical structure development
GO:0048869	P	cellular developmental process
GO:0050789	P	regulation of biological process
GO:0050794	P	regulation of cellular process
GO:0051171	P	regulation of nitrogen compound metabolic process
GO:0051252	P	regulation of RNA metabolic process
GO:0051301	P	cell division
GO:0060255	P	regulation of macromolecule metabolic process
GO:0060560	P	developmental growth involved in morphogenesis
GO:0065007	P	biological regulation
GO:0071695	P	anatomical structure maturation
GO:0071840	P	cellular component organization or biogenesis
GO:0080090	P	regulation of primary metabolic process
GO:0080147	P	root hair cell development
GO:0090558	P	plant epidermis development
GO:0090627	P	plant epidermal cell differentiation
GO:0097159	F	organic cyclic compound binding
GO:0099402	P	plant organ development
GO:1901363	F	heterocyclic compound binding
GO:1903506	P	regulation of nucleic acid-templated transcription
GO:2000112	P	regulation of cellular macromolecule biosynthetic process
GO:2001141	P	regulation of RNA biosynthetic process
GO:0140110
GO:1905392

KEGG pathway

KO	Name	Enzyme ID	Pathway	Pathway ID
-	-	-	-	-

Expression pattern in different tissues

Expression pattern in BioProjects

Co-expression network