result

Gene information

Detail information of g88223

Location

Gene	Chr	Start	End	Strand
g88223	Scaffold_36606:HRSCAF_382307	275448	276774	-

Sequences

CDS

>g88223.t1
ATGGAGAACAGTGCTTATCACGCATATCTTCCTCACATGTCCTTTGATTCAACATCATCACAAACAATGCCAAGTTCTTACATCATCAATGATTCTTCATTACCCAGTCTATATATGAACAACAGCATGAATATTACCCCTCATGTTGGGAATACTGCGTTTGATAATATCATGGGAATTTCCATGCCTACCGAGTCATTCACTTATGATCACGAGATGCAAACACCAAAACATGCTGAAAATTCGAATGCGCTTCATGACTACAAACCTCAAATTCCTAAAACAGTGAGTAGAGTTTGCCCGACTTATCATATTTTAGGAAACTTGGAGAAGTCTACTCCTGTGAACTTTGATCCTTCATGCAGTAGTTATTATACTCCAAATAATGAGCTGTCTCTTAGCCTTGGCAACTCCGAAATGAGTTGCACGAGTTTCACACACGAATCAAGTTGTTTTCCATTCCCTGATCATGCAAATTTGGAGACAAGATTTCTTCGTGTAATGCAAGAAATACTTTCGGAAATCACTAGCTATGCATCAGGAGATCTTGATGATGATCAAATTGATGAAAATGAAGCAGAAGAAATTATATCTTACTCTTCGAGTAGTTCCAGTGCAAATGGAATTCATGCTGCAACCAAAGATGATTTCCGGTGTTCTACCCGAGAGACTGTTTGTACAAAGAAGGCTGAGTTGCTAAACTTGCTTCAAATGATTGATAGCCAATGCAACCAATATCTAAACCAAATACAGAGCACAATGTCTAAATACCAAGGAAAAATCAACCAAGGAATTCCTCAAATGAATGCGCGATTCACCACTCAGAAAATCTCCATCTTCTACAGAAATCTAAGAAATAGAATCGCTAGTCATATCTTATCAACCAATGAGCATTATGTTCAGGAATCTGCTATGGAAAAAGAAAGAAGCTTCGAAACATCATTTGTACAAAAACATTGGGCTCTTCAGCAGCTTAAGAGAAACGAGCATCAGTCCTGGAGACCCCAAAGAGGCTTGCCCGAAAAATCTGTTCTGTATTAA

Protein

Gene

>g88223.t1
ATGGAGAACAGTGCTTATCACGCATATCTTCCTCACATGTCCTTTGATTCAACATCATCACAAACAATGCCAAGTTCTTACATCATCAATGATTCTTCATTACCCAGTCTATATATGAACAACAGCATGAATATTACCCCTCATGTTGGGAATACTGCGTTTGATAATATCATGGGAATTTCCATGCCTACCGAGTCATTCACTTATGATCACGAGATGCAAACACCAAAACATGCTGAAAATTCGAATGCGCTTCATGACTACAAACCTCAAATTCCTAAAACAGTGAGTAGAGTTTGCCCGACTTATCATATTTTAGGAAACTTGGAGAAGTCTACTCCTGTGAACTTTGATCCTTCATGCAGTAGTTATTATACTCCAAATAATGAGCTGTCTCTTAGCCTTGGCAACTCCGAAATGAGTTGCACGAGTTTCACACACGAATCAAGTTGTTTTCCATTCCCTGATCATGCAAATTTGGAGACAAGATTTCTTCGTGTAATGCAAGAAATACTTTCGGAAATCACTAGCTATGCATCAGGAGATCTTGATGATGATCAAATTGATGAAAATGAAGCAGAAGAAATTATATCTTACTCTTCGAGTAGTTCCAGTGCAAATGGAATTCATGCTGCAACCAAAGATGATTTCCGGTGTTCTACCCGAGAGACTGTTTGTACAAAGAAGGCTGAGTTGCTAAACTTGCTTCAAATGGTATGTGATATATATGTTCAAATGGGGGGATGTGTGCATGTGTTAAAAATGGTGATATTAACATTTGAGCCACCAGTCTTTGACATGTTAAATTAGCTAGTGTTGATAGTTGCATTTTCAAAATCTATGTATTAAAATTTTGGCATGAAATATGAGAACCATAAACGTTACATGCAATAAGTTCTAGTGTAAATGTGAGGTATCCAAAATGGATGGATAATGAATAATGAGATCTCTCAGAAAAATAGTAATGTGGTTGTGCTAACCTTTTAAATTTATTTTATAGATTGATAGCCAATGCAACCAATATCTAAACCAAATACAGAGCACAATGTCTAAATACCAAGGAAAAATCAACCAAGGAATTCCTCAAATGAATGCGCGATTCACCACTCAGAAAATCTCCATCTTCTACAGAAATCTAAGAAATAGAATCGCTAGTCATATCTTATCAACCAATGAGCATTATGTTCAGGAATCTGCTATGGAAAAAGAAAGAAGCTTCGAAACATCATTTGTACAAAAACATTGGGCTCTTCAGCAGCTTAAGAGAAACGAGCATCAGTCCTGGAGACCCCAAAGAGGCTTGCCCGAAAAATCTGTTCTGTATTAA

Functional annotation

Database	accession number	e-value	annotation
nr	XP_020249125.1	3.6e-41	homeobox protein ATH1-like
Swissprot	P48731.1	4.2e-18	Homeobox protein ATH1
trEMBL	A0A843UM04	4.9e-32	Homeobox domain-containing protein

Best hit in Arabidopsis

TAIR id	% identity	e-value	bit score	gene aliases	Short description
AT4G32980.1	34.69	2e-22	103	ATH1	homeobox gene 1

>>>Show top 3 blast result

Query id	Subject id	alignment length	mis matches	gap openings	query start	query end	subject start	subject end	% identity	e-value	bit score
g88223	AT4G32980.1	245	121	10	128	344	151	384	34.69	2e-22	103
g88223	AT2G35940.3	139	84	3	216	344	259	397	32.37	4e-12	69.3
g88223	AT2G35940.2	139	84	3	216	344	259	397	32.37	4e-12	69.3

Ortholog group

Species	Genes
Allium cepa	g86301.t1; g88223.t1
Allium fistulosum	AfisC1G06267; AfisC1G07970; AfisC1G07972; AfisC2G04220; AfisC8G05951
Allium sativum	Asa6G01838.1
Arabidopsis thaliana	AT4G32980.1
Oryza sativa	LOC_Os02g13310.1

Pfam domain

Pfam ID	Pfam name	type	alignment_start	alignment_end	bit_score	Evalue
PF07526.8	POX	Domain	161	289	70.5	1.9e-19

Gene Ontology

Accession	Ontology	Name
GO:0000003	P	reproduction
GO:0005622	C	intracellular
GO:0005575	C	cellular_component
GO:0003006	P	developmental process involved in reproduction
GO:0003674	F	molecular_function
GO:0003676	F	nucleic acid binding
GO:0003677	F	DNA binding
GO:0003700	F	transcription factor activity, sequence-specific DNA binding
GO:0005488	F	binding
GO:0005623	C	cell
GO:0005634	C	nucleus
GO:0043231	C	intracellular membrane-bounded organelle
GO:0006355	P	regulation of transcription, DNA-templated
GO:0007275	P	multicellular organism development
GO:0009653	P	anatomical structure morphogenesis
GO:0008150	P	biological_process
GO:0008285	P	negative regulation of cell proliferation
GO:0009314	P	response to radiation
GO:0009416	P	response to light stimulus
GO:0009628	P	response to abiotic stimulus
GO:0009639	P	response to red or far red light
GO:0009640	P	photomorphogenesis
GO:0009791	P	post-embryonic development
GO:0009838	P	abscission
GO:0009889	P	regulation of biosynthetic process
GO:0009908	P	flower development
GO:0010227	P	floral organ abscission
GO:0010228	P	vegetative to reproductive phase transition of meristem
GO:0010371	P	regulation of gibberellin biosynthetic process
GO:0010468	P	regulation of gene expression
GO:0010556	P	regulation of macromolecule biosynthetic process
GO:0010565	P	regulation of cellular ketone metabolic process
GO:0010817	P	regulation of hormone levels
GO:0048646	P	anatomical structure formation involved in morphogenesis
GO:0019216	P	regulation of lipid metabolic process
GO:0019219	P	regulation of nucleobase-containing compound metabolic process
GO:0019222	P	regulation of metabolic process
GO:0019747	P	regulation of isoprenoid metabolic process
GO:0022414	P	reproductive process
GO:0031323	P	regulation of cellular metabolic process
GO:0031326	P	regulation of cellular biosynthetic process
GO:0032350	P	regulation of hormone metabolic process
GO:0032501	P	multicellular organismal process
GO:0032502	P	developmental process
GO:0042127	P	regulation of cell proliferation
GO:0043226	C	organelle
GO:0043227	C	membrane-bounded organelle
GO:0043229	C	intracellular organelle
GO:0043455	P	regulation of secondary metabolic process
GO:0043565	F	sequence-specific DNA binding
GO:0044424	C	intracellular part
GO:0044464	C	cell part
GO:0046885	P	regulation of hormone biosynthetic process
GO:0046890	P	regulation of lipid biosynthetic process
GO:0048367	P	shoot system development
GO:0048437	P	floral organ development
GO:0048519	P	negative regulation of biological process
GO:0048523	P	negative regulation of cellular process
GO:0048608	P	reproductive structure development
GO:0048731	P	system development
GO:0048856	P	anatomical structure development
GO:0048859	P	formation of anatomical boundary
GO:0050789	P	regulation of biological process
GO:0050794	P	regulation of cellular process
GO:0050896	P	response to stimulus
GO:0051171	P	regulation of nitrogen compound metabolic process
GO:0051252	P	regulation of RNA metabolic process
GO:0060255	P	regulation of macromolecule metabolic process
GO:0061458	P	reproductive system development
GO:0065007	P	biological regulation
GO:0065008	P	regulation of biological quality
GO:0080090	P	regulation of primary metabolic process
GO:0090470	P	shoot organ boundary specification
GO:0090567	P	reproductive shoot system development
GO:0097159	F	organic cyclic compound binding
GO:0099402	P	plant organ development
GO:1901363	F	heterocyclic compound binding
GO:1903506	P	regulation of nucleic acid-templated transcription
GO:2000112	P	regulation of cellular macromolecule biosynthetic process
GO:2001141	P	regulation of RNA biosynthetic process
GO:0062012
GO:0090691
GO:0140110

KEGG pathway

KO	Name	Enzyme ID	Pathway	Pathway ID
-	-	-	-	-

Expression pattern in different tissues

Expression pattern in BioProjects

Co-expression network