result

Gene information

Detail information of g951

Location

Gene	Chr	Start	End	Strand
g951	CHR5	218075521	218078487	-

Sequences

CDS

Protein

Gene

>g951.t1
ATGGTTGATATGGAAATTGAGCGAATCAGTGAATCAAGATTAGAGTTTGGTTGCTGCCACTGGATTTTGATGATTATTTTCGGATTTTACATGTAGGGTTGGAGACATATTACTGCTCTTTTGCTCTTCTCTGTTTGATATTCTCGCTCTGATTTTATACCTGATTTAGTTTAGAAAATATTTTTTATTGAAGATAGATTAGAAGTTATAAAAATGAATAGTGGTAATTTGAGAAGAAACGGCAGCGGGCCAGCGCCATTTTCGGTAAAGACACATTGGATGGTGGAAGCCGAAAATATGAATGATATAATAAGTTGGGGAGAAATGGGAAATTCTTTCGTTGTCTAGAAGCCTATTGAGTTTGTTAGGGATTTTCTTCCCGTTCATTTCAAGCATAATAACTTTTCCAACTTTGTAAGGCAGCTTAATACATATGTGAGTTTTCTCTTTTACTTTTCTTCTTGATTTTTATACATTTATTCTAACTTATATGCGATCTTGATTTATGTGGTGTTTTTGTGACAAAGAGATTGAATTTTCATTACCATTGCTATAAAAAGTAGATCACGATTATGCTTTGGAGTTCTCTTTGCAATCAAACCATACAAGACTTATTTACATTGAAGCCCTTTTGATCAACGTTTAATTTCCTACCATAAGTAGGTGTAGATTCCGACCTCCAAATTTGGCCCAAAAAAAAGGCCAACGTGGCTGGTATGGATGCCTCAAGTTATTTGGATTATAAATGAATATAAATCATGTGAGGATGTCCTCACATGTATGGTAAAAAGAGATGTCATGAATTTTATGTGTAGTTGGTCCTCAGTCCAAATTGCTTAATCTAATGAAGTAAGATCAATGTCGCTAAACTAGAAATAGCCAGTTATTGAAAATATAGAGGATGAGTGTGGAAAATTGGAAGAGGGATTGGTATTTGGAGCAAAAAAACCAGTTACACGTAAATTTGTAATCAAAAAGCATGTTTTGGTTGTTAAGAGTTCAGACAAATATTTTATCATAGAACAATCATTTTTTGGCCTGCTGAACTCATGAGTTATATGGTTTTATGGTGGAGAAGAGATGTCACATTTACGGAAAACATATTGCATATTGTTCCACTGTCTAATGTACAACAGATCTTCAAGTGTCCAATCAATGTAACTTCTACTTTTTTTTGTTCACTCAAGCATAAACAAAATGTTTTGCTTTGCTTCTGTATTTGCTTTAGTATGAGCTTATTCTTTTGAGATAGTTTCTCTACTTTCAATAATAGGAGTAGTTGTAAAATAAGACATTAGTAAAAATAAAATATATTCAAATTTTAGAGGCTGGTATAGAATGGATGGACTGAAATCGGCATTTAAGCACGTGAAGGGTGTGCCCATTCGCATTAAGGACAGTTGTCTTAATATAGCACATGAATATAAGTATTTTTCCCCCTTCATTTTGTTACATGGCTTCCGTTGCACGCGCTAATTTTTATGACAAGATTTTGAACTTGGTTCCATCTTGGCTCTTGATGAGGTGGAAACTTTGGAAAAATAATAAAAGAATGAAGCAAAATTTCATTTCATCATAATGGTGCTTTTATAAAAACAAAATAAAAATTAAAATAAATCATAATACTGATGCTATTTTGAAAATGCTTACAGGGTATTTTGAGACCTTTTTTGTTGAACATCCATAGAGAAAAGTAG

Functional annotation

Database	accession number	e-value	annotation
nr	XP_009410099.1	1.7e-10	PREDICTED: heat stress transcription factor B-1-like
Swissprot	Q67TP9.1	5.8e-08	Heat stress transcription factor 23
trEMBL	A0A804JXR8	1.2e-10	(wild Malaysian banana) hypothetical protein

Best hit in Arabidopsis

TAIR id	% identity	e-value	bit score	gene aliases	Short description
AT1G32330.1	80.00	1e-09	58.2	ATHSFA1D;HSFA1D	heat shock transcription factor A1D

>>>Show top 3 blast result

Query id	Subject id	alignment length	mis matches	gap openings	query start	query end	subject start	subject end	% identity	e-value	bit score
g951	AT1G32330.1	30	6	0	60	89	68	97	80.00	1e-09	58.2
g951	AT4G11660.1	30	7	0	60	89	90	119	76.67	1e-09	58.2
g951	AT1G46264.1	63	12	1	49	89	32	94	46.03	4e-09	56.6

Ortholog group

Species	Genes
Allium cepa	g187437.t1; g356778.t1; g951.t1
Allium fistulosum	AfisC6G05089
Allium sativum	Asa0G00718.1; Asa0G03403.1; Asa8G02166.1
Arabidopsis thaliana
Oryza sativa	LOC_Os09g28354.1

Pfam domain

Pfam ID	Pfam name	type	alignment_start	alignment_end	bit_score	Evalue
PF00447.14	HSF_DNA-bind	Family	60	90	33.6	4e-08

Gene Ontology

Accession	Ontology	Name
GO:0005622	C	intracellular
GO:0005575	C	cellular_component
GO:0003674	F	molecular_function
GO:0003700	F	transcription factor activity, sequence-specific DNA binding
GO:0005623	C	cell
GO:0005634	C	nucleus
GO:0043231	C	intracellular membrane-bounded organelle
GO:0006355	P	regulation of transcription, DNA-templated
GO:0006950	P	response to stress
GO:0008150	P	biological_process
GO:0009266	P	response to temperature stimulus
GO:0009408	P	response to heat
GO:0009628	P	response to abiotic stimulus
GO:0009889	P	regulation of biosynthetic process
GO:0009890	P	negative regulation of biosynthetic process
GO:0009892	P	negative regulation of metabolic process
GO:0010468	P	regulation of gene expression
GO:0010556	P	regulation of macromolecule biosynthetic process
GO:0010558	P	negative regulation of macromolecule biosynthetic process
GO:0010605	P	negative regulation of macromolecule metabolic process
GO:0010629	P	negative regulation of gene expression
GO:0045892	P	negative regulation of transcription, DNA-templated
GO:0019219	P	regulation of nucleobase-containing compound metabolic process
GO:0019222	P	regulation of metabolic process
GO:0031323	P	regulation of cellular metabolic process
GO:0031324	P	negative regulation of cellular metabolic process
GO:0031326	P	regulation of cellular biosynthetic process
GO:0031327	P	negative regulation of cellular biosynthetic process
GO:0043226	C	organelle
GO:0043227	C	membrane-bounded organelle
GO:0043229	C	intracellular organelle
GO:0044424	C	intracellular part
GO:0044464	C	cell part
GO:0045934	P	negative regulation of nucleobase-containing compound metabolic process
GO:0048519	P	negative regulation of biological process
GO:0048523	P	negative regulation of cellular process
GO:0050789	P	regulation of biological process
GO:0050794	P	regulation of cellular process
GO:0050896	P	response to stimulus
GO:0051171	P	regulation of nitrogen compound metabolic process
GO:0051172	P	negative regulation of nitrogen compound metabolic process
GO:0051252	P	regulation of RNA metabolic process
GO:0051253	P	negative regulation of RNA metabolic process
GO:0060255	P	regulation of macromolecule metabolic process
GO:0065007	P	biological regulation
GO:0080090	P	regulation of primary metabolic process
GO:1902679	P	negative regulation of RNA biosynthetic process
GO:1903506	P	regulation of nucleic acid-templated transcription
GO:1903507	P	negative regulation of nucleic acid-templated transcription
GO:2000112	P	regulation of cellular macromolecule biosynthetic process
GO:2000113	P	negative regulation of cellular macromolecule biosynthetic process
GO:2001141	P	regulation of RNA biosynthetic process
GO:0140110

KEGG pathway

KO	Name	Enzyme ID	Pathway	Pathway ID
K09419	HSFF; heat shock transcription factor, other eukaryote	EC:-	-	-

Expression pattern in different tissues

Expression pattern in BioProjects

Co-expression network