result

Gene information

Detail information of AfisC1G00869

Location

Gene	Chr	Start	End	Strand
AfisC1G00869	chr1	140069270	140070361	+

Sequences

CDS

Protein

Gene

>AfisC1G00869
GTCAGGGTATGTAGGGAAAAGTCAACTGGCCATGTTTATACAATGAAGAAGCTAAACATGTATGAAATGGTTCGTCATGGACAGGTTTTTATATATAATAATTCTTCTATTGTACCCTTTGTTTTGCTTATCAACCTCTATAATTTGGTTGAAAACTTCCTAACATAATTTTGACCTATGATGTTGTTACCTATAGTTAAACCCATTACTCATGAAAATTCTGGAATGTATTGGCAGACACTTTGTGCTATATCTTTATCTTTTTTGCACATTAAATAAATTAAGGGTGTTAAATAAATGAAGGAAAAAGTTAATAAAGTGGTTCAGCTAATCTAGAAATAACACTTATAAATTTTCAACATTGAGATTTTAATCCTCTCTAATACACATGCAACATGGAACTCCAATATTGATTGACATCTCAATCAAAGGTTTAGTATTGATATACCGTTCGCATGTTGTTCATTTTGAAATTATCCAATCAAAGTACCAGTAATAATAATATAATATACAAAATATTGTCTACATATGCTATGGGTATACATCATGATAAAGTATATGGAACTTAAATTGGAAAAAAAGACATGAACTCTTTAATATATTGGAACTGCAGAATATTTTCCTAGCCTTGTATGAAACATGTTGTTTATCAATAATTTACTTAGAGGAAAAGAATCTTGGCACACAATTCACCGATGCTACACAAATTATTTACTGTTGCTAAAGTGGATTAAACAATAATTTATGTACATATTTTCTTTAATATTCCATTACTCAAGTTAGATAGCATTTTCTAGAAGTTCCATACTCTTCAAATTTACATATCACCTGAACATTTTACTTTTTCAAAGTTGAGCATGTTAAAGCTGAGAGAGATCTTCTTGCACAAGTCCATAGTAATTGCATTGTTAAATTGTATTGTTCATTCCAAGACATGGATTTTCTATATCTAATCTTGGAATATTTACTGGGTGGAGATCTGATAACACCGCTCATGAGAAAAGATGAATTGAGCGAGGATATGGCTAGATTCTATGTTGCTGAGGCAGTTCTTGCCTTAGAGTCAATACACAAGCACAATTATGCTCATAG

Functional annotation

Database	accession number	e-value	annotation
nr	XP_010262359.1	1.3e-37	PREDICTED: serine/threonine-protein kinase tricorner isoform X1
Swissprot	Q6TGC6.1	5.0e-23	Serine/threonine-protein kinase CBK1
trEMBL	A0A1U8AJE9	9.1e-38	serine/threonine-protein kinase tricorner isoform X1

Best hit in Arabidopsis

TAIR id	% identity	e-value	bit score	gene aliases	Short description
AT3G23310.1	73.15	2e-42	166		AGC (cAMP-dependent, cGMP-dependent and protein kinase C) kinase family protein

>>>Show top 3 blast result

Query id	Subject id	alignment length	mis matches	gap openings	query start	query end	subject start	subject end	% identity	e-value	bit score
AfisC1G00869	AT3G23310.1	108	27	1	1	106	134	241	73.15	2e-42	166
AfisC1G00869	AT4G14350.2	108	28	1	1	106	133	240	72.22	3e-42	166
AfisC1G00869	AT4G14350.1	108	28	1	1	106	133	240	72.22	3e-42	166

Ortholog group

Species	Genes
-	-

Pfam domain

Pfam ID	Pfam name	type	alignment_start	alignment_end	bit_score	Evalue
PF00069.22	Pkinase	Domain	1	106	58.8	4.6e-16

Gene Ontology

Accession	Ontology	Name
GO:0005886	C	plasma membrane
GO:0000131	C	incipient cellular bud site
GO:0000287	F	magnesium ion binding
GO:0000920	P	cell separation after cytokinesis
GO:0001411	C	hyphal tip
GO:0004674	F	protein serine/threonine kinase activity
GO:0005524	F	ATP binding
GO:0005628	C	prospore membrane
GO:0005913	C	cell-cell adherens junction
GO:0005934	C	cellular bud tip
GO:0005935	C	cellular bud neck
GO:0005938	C	cell cortex
GO:0006357	P	regulation of transcription from RNA polymerase II promoter
GO:0007118	P	budding cell apical bud growth
GO:0009267	P	cellular response to starvation
GO:0010494	C	cytoplasmic stress granule
GO:0015629	C	actin cytoskeleton
GO:0018105	P	peptidyl-serine phosphorylation
GO:0022416	P	chaeta development
GO:0030031	P	cell projection assembly
GO:0030308	P	negative regulation of cell growth
GO:0030424	C	axon
GO:0030425	C	dendrite
GO:0030428	C	cell septum
GO:0030950	P	establishment or maintenance of actin cytoskeleton polarity
GO:0031435	F	mitogen-activated protein kinase kinase kinase binding
GO:0031579	P	membrane raft organization
GO:0034605	P	cellular response to heat
GO:0035317	P	imaginal disc-derived wing hair organization
GO:0035690	P	cellular response to drug
GO:0036170	P	filamentous growth of a population of unicellular organisms in response to starvation
GO:0036180	P	filamentous growth of a population of unicellular organisms in response to biotic stimulus
GO:0036244	P	cellular response to neutral pH
GO:0040018	P	positive regulation of multicellular organism growth
GO:0043332	C	mating projection tip
GO:0043407	P	negative regulation of MAP kinase activity
GO:0044297	C	cell body
GO:0048800	P	antennal morphogenesis
GO:0048814	P	regulation of dendrite morphogenesis
GO:0051286	C	cell tip
GO:0060237	P	regulation of fungal-type cell wall organization
GO:0060560	P	developmental growth involved in morphogenesis
GO:0061246	P	establishment or maintenance of bipolar cell polarity regulating cell shape
GO:0070451	C	cell hair
GO:0070593	P	dendrite self-avoidance
GO:0070688	C	MLL5-L complex
GO:0098609	P	cell-cell adhesion
GO:0098641	F	cadherin binding involved in cell-cell adhesion
GO:1900233	P	positive regulation of single-species biofilm formation on inanimate substrate
GO:1900433	P	positive regulation of filamentous growth of a population of unicellular organisms in response to heat
GO:1900442	P	positive regulation of filamentous growth of a population of unicellular organisms in response to neutral pH

KEGG pathway

KO	Name	Enzyme ID	Pathway	Pathway ID
-	-	-	-	-

Expression pattern in different tissues

Expression pattern in BioProjects

Co-expression network