result

Gene information

Detail information of AfisC3G05106

Location

Gene	Chr	Start	End	Strand
AfisC3G05106	chr3	908538754	908540138	+

Sequences

CDS

Protein

Gene

>AfisC3G05106
AAACTACATCCCAATTTCGTGTCCTCTCCGACCTGAATCCGCCGCCTTTGACGGAAGAATCTACGCCGACCAAGATCTGCGCTTCTATCCCAAATCCCGTCGTCCGACTCCAAAAAGCGAGCCTCGGCCTCTGTGCCCTAAACGAGCCATCCGACCCAAATAACTTCGCCTCCGCCTCTCAGCATCGCCGTGCCGGCCTCTGCTCTCCATTCTTCATAGTCAAAGATATACTGCCAGGCTAAATTGAATGGATCGGTATGAGAAAGTAAAGAAGATTGGAGAAGGGAACTACGGAGTTGTTTACAAAGCTCGGGATCGACTCACAAATGAAGTGATTGCTTTGAAGAAGATCAGTTTGGAACCGGACGAATATAATGGAGTTCCTAGTTCTGTTATTAGAGAAATATCACTACTGAAGGAAATGCAACATGCTAACATTGTCAGGTTGCAGGATGCAATTCTCACTGAGAAGTGGATGTGTCTTGTGTTCGAGTATATGGATCTGGACCTTAAGAAGCATATGGATTCATGCCCAGATTTTGCTAACGATTCTCGTTTGGCCAAAACATTCCTCCATCAAATTCTCCAAGGAATTGCTTATTGCCACTCACACGGGTTTCTTCATCGGGACCTAAAACCTCAGAATTTATTGATTGACAGACGAAATAATTCATTGAAGATCGCCGACTTTGGAATTTCTAGGGCAATTGGTATCTCCCCTGTCCGAACCTTGACAAATGAGGTTGTGACACTTTGGTATCGGGCACCTGAAATCCTCTTGGGTGATGCTAAGTATAATGCTCGTATAGACATATGGTCTATAGGATGTATCTTTGCCGAAATGGTGAACCAACAACCTCTATTCCCTGGGGAGTCTGAGATTGATGAGCTGTTCAAAATATTTAGAGTTATGGGCACTCCAAACACTGAGACGTGGCCAGGTGTTACTTCATTGCCTGACTTCAAGTTTTCTTTTCCAATGTGGCCAGCCAAGGACTTGGCAACAGTAGTCCCAAAGCTTGATTCAGCTGGAATTGACCTTCTTTATAAAATGTTGCAGCTTGACCCGAGCAAAAGAATCTCAGCTCGACAGGCTCTTAAGCACGAATACTTCAAGGATATTGGGACAACTCCATGAAGAAACAGGCAATCTTCTTCCCTATATATTATATATTATTATGGCCATTGCATAAAGCATTGGTATATTTGAGTGTGATCCTTTATTTTACTTCAAGTTTTTATTTACCATTTGTTCTGGTTTGTTTATCTTAGACAGCAAGGGAGCCTCCACTTATCCCTAAGTCGTGCAAATGAACTTGTATCTTTTTCCTTTTGTCTTTGTTTTCTTTTTTCTGTGGTGTTTAAAAAAGAAGAAGTTATTTATA

Functional annotation

Database	accession number	e-value	annotation
nr	BAA21673.1	6.5e-103	cdc2 kinase
Swissprot	Q38772.2	3.1e-102	Cell division control protein 2 homolog A
trEMBL	O22292	4.7e-103	Cdc2 kinase

Best hit in Arabidopsis

TAIR id	% identity	e-value	bit score	gene aliases	Short description
AT3G48750.1	73.48	4e-100	360	CDC2;CDC2A;CDC2AAT;CDK2;CDKA1;CDKA;1	cell division control 2

>>>Show top 3 blast result

Query id	Subject id	alignment length	mis matches	gap openings	query start	query end	subject start	subject end	% identity	e-value	bit score
AfisC3G05106	AT3G48750.1	230	59	2	1	230	1	228	73.48	4e-100	360
AfisC3G05106	AT2G38620.2	249	106	6	1	232	1	247	49.80	2e-67	252
AfisC3G05106	AT3G54180.1	247	111	5	1	232	1	245	48.18	1e-63	239

Ortholog group

Species	Genes
-	-

Pfam domain

Pfam ID	Pfam name	type	alignment_start	alignment_end	bit_score	Evalue
PF00069.22	Pkinase	Domain	4	230	226.3	3.7e-67

Gene Ontology

Accession	Ontology	Name
GO:0005886	C	plasma membrane
GO:0000083	P	regulation of transcription involved in G1/S transition of mitotic cell cycle
GO:0000187	P	activation of MAPK activity
GO:0000307	C	cyclin-dependent protein kinase holoenzyme complex
GO:0000784	C	nuclear chromosome, telomeric region
GO:0000803	C	sex chromosome
GO:0003682	F	chromatin binding
GO:0005739	C	mitochondrion
GO:0005829	C	cytosol
GO:0004693	F	cyclin-dependent protein serine/threonine kinase activity
GO:0005524	F	ATP binding
GO:0005654	C	nucleoplasm
GO:0005667	C	transcription factor complex
GO:0005813	C	centrosome
GO:0005876	C	spindle microtubule
GO:0006281	P	DNA repair
GO:0006461	P	protein complex assembly
GO:0006813	P	potassium ion transport
GO:0006977	P	DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest
GO:0007067	P	mitotic nuclear division
GO:0007077	P	mitotic nuclear envelope disassembly
GO:0007095	P	mitotic G2 DNA damage checkpoint
GO:0007098	P	centrosome cycle
GO:0007344	P	pronuclear fusion
GO:0007569	P	cell aging
GO:0043066	P	negative regulation of apoptotic process
GO:0008353	F	RNA polymerase II carboxy-terminal domain kinase activity
GO:0008356	P	asymmetric cell division
GO:0042493	P	response to drug
GO:0009636	P	response to toxic substance
GO:0009409	P	response to cold
GO:0009555	P	pollen development
GO:0009574	C	preprophase band
GO:0009793	P	embryo development ending in seed dormancy
GO:0010005	C	cortical microtubule, transverse to long axis
GO:0010235	P	guard mother cell cytokinesis
GO:0010444	P	guard mother cell differentiation
GO:0014038	P	regulation of Schwann cell differentiation
GO:0014070	P	response to organic cyclic compound
GO:0014075	P	response to amine
GO:0014823	P	response to activity
GO:0016477	P	cell migration
GO:0045893	P	positive regulation of transcription, DNA-templated
GO:0016572	P	histone phosphorylation
GO:0018105	P	peptidyl-serine phosphorylation
GO:0018107	P	peptidyl-threonine phosphorylation
GO:0046686	P	response to cadmium ion
GO:0030261	P	chromosome condensation
GO:0030332	F	cyclin binding
GO:0030496	C	midbody
GO:0030544	F	Hsp70 protein binding
GO:0030855	P	epithelial cell differentiation
GO:0031100	P	organ regeneration
GO:0031145	P	anaphase-promoting complex-dependent catabolic process
GO:0033160	P	positive regulation of protein import into nucleus, translocation
GO:0034501	P	protein localization to kinetochore
GO:0035173	F	histone kinase activity
GO:0040020	P	regulation of meiotic nuclear division
GO:0042023	P	DNA endoreduplication
GO:0045023	P	G0 to G1 transition
GO:0046688	P	response to copper ion
GO:0045471	P	response to ethanol
GO:0045740	P	positive regulation of DNA replication
GO:0045931	P	positive regulation of mitotic cell cycle
GO:0045995	P	regulation of embryonic development
GO:0048678	P	response to axon injury
GO:0051436	P	negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle
GO:0051437	P	positive regulation of ubiquitin-protein ligase activity involved in regulation of mitotic cell cycle transition
GO:0055015	P	ventricular cardiac muscle cell development
GO:0060045	P	positive regulation of cardiac muscle cell proliferation
GO:0070062	C	extracellular exosome
GO:0070301	P	cellular response to hydrogen peroxide
GO:0072686	C	mitotic spindle
GO:0090166	P	Golgi disassembly
GO:0098725	P	symmetric cell division

KEGG pathway

KO	Name	Enzyme ID	Pathway	Pathway ID
-	-	-	-	-

Expression pattern in different tissues

Expression pattern in BioProjects

Co-expression network