result

Gene information

Detail information of AfisC5G02512

Location

Gene	Chr	Start	End	Strand
AfisC5G02512	chr5	480163010	480164207	-

Sequences

CDS

Protein

Gene

>AfisC5G02512
ATGAGCTTCCTAAAACAAGAACATCTCAAAGTAACATCAACTGGTAGTAAACAATCAAAGATATTTAGTAGAGGTCATTGGAAACCAAGTGAAGATGCAATGCTAAGAGAACTTGTCTCTCTACATGGCCCTCAAAACTGGAACCTCATTGCTCAAAAATTACAAGGAAGATCAGGTACGTATATTCCTAACACAAATGAAATTAATCAACCAAATATTGTACTGAGCATGCTAAATACAGGGAAGAGTTGTAGATTGAGATGGTTTAATCAGCTAGACCCGAAAATAAACAAGAGAGCATTCAGCGAAATGGAAGAAGAAAGACTTCTTCAAGCACATGAAGCTTACGGAAACAGATGGGCAATGATAGCTAGGCTTTTTCCAGGAAGAACAGATAATGCAGTTAAGAATCATTGGCATGTTATAATGGCTAGAAAGCAGAGAGAACAATATTCAGGTTCTATACGAAGAAGAACCAAGTTCACTGAGTTCAACAATGCATTCAGCGGAGAATCAAGTCTTACAAGTACTAAAGATGAATCAGTTTCGAATCATTCCTTGAATTACTCGGTTAGTAACAAGATTGTTCCTCAAATATTTAGGAGGTGTTTTGATCAAGAAATTCAAGAACCACATAGTTTTGATTTTGCTATAGGTATGTTCATGTTTGTTTTTTTTCCTTCAATAGGCAGCCCATCAAATTTATACCTTTGAAAGCTTATATTTGAAAATGAACCTCTATGTAGGCACAAATGGAAAAGTGAAGACTTCAAATACTGATATCTATTATGAGAAGCACGGTCAGTTTGGTAATGGTGCATTTCTCGATCGAGTAGTCATTTTTAATCCAACAATTTTGGGTACTTCAGCAAATGAATGCTTGTCTGACAAAATAACAAAGGGCGATCAGAATGTAAAGAAGAGACTACGCTACTTCGATTTCCTCGGTGTAGGAGAAACATAAAAGAAATGTTTCCAAATAAAGAAGGCAATAGGTACTAGAGATGAAGTGAAACTTTGAGGGAAAAAACCGTGTAAAAATGTAGTCTTGCACTGTTATCTTGTACTAGAGTTAACTCGCTTTGTAACCAATGAAGAATGTTGATGCATGAAATCATTCCTCTTTAACCTTCATGGGAAACAAATTAAAAAATGAGGATGAGTTATGGTTTTAAATTCTAAAATGCTAATGTTTAGC

Functional annotation

Database	accession number	e-value	annotation
nr	XP_009406840.1	2.4e-61	PREDICTED: myb-related protein Zm1-like
Swissprot	Q9SEZ4.1	2.9e-51	Protein LATERAL ORGAN FUSION 2
trEMBL	A0A804JNF9	1.8e-61	(wild Malaysian banana) hypothetical protein

Best hit in Arabidopsis

TAIR id	% identity	e-value	bit score	gene aliases	Short description
AT1G69560.1	74.40	3e-54	208	ATMYB105;LOF2;MYB105	myb domain protein 105

>>>Show top 3 blast result

Query id	Subject id	alignment length	mis matches	query start	query end	subject start	subject end	% identity	e-value	bit score
AfisC5G02512	AT1G69560.1	125	32	13	137	96	220	74.40	3e-54	208
AfisC5G02512	AT1G26780.2	116	28	21	136	95	210	75.86	1e-52	202
AfisC5G02512	AT1G26780.1	116	28	21	136	95	210	75.86	2e-52	202

Ortholog group

Species	Genes
-	-

Pfam domain

Pfam ID	Pfam name	type	alignment_start	alignment_end	bit_score	Evalue
PF00249.28	Myb_DNA-binding	Domain	24	69	59.8	1.9e-16
PF00249.28	Myb_DNA-binding	Domain	77	118	51.2	9e-14

Gene Ontology

Accession	Ontology	Name
GO:0000122	P	negative regulation of transcription from RNA polymerase II promoter
GO:0000978	F	RNA polymerase II core promoter proximal region sequence-specific DNA binding
GO:0001046	F	core promoter sequence-specific DNA binding
GO:0001077	F	transcriptional activator activity, RNA polymerase II core promoter proximal region sequence-specific binding
GO:0001135	F	transcription factor activity, RNA polymerase II transcription factor recruiting
GO:0001935	P	endothelial cell proliferation
GO:0042742	P	defense response to bacterium
GO:0050832	P	defense response to fungus
GO:0005829	C	cytosol
GO:0006338	P	chromatin remodeling
GO:0009414	P	response to water deprivation
GO:0009555	P	pollen development
GO:0009651	P	response to salt stress
GO:0009723	P	response to ethylene
GO:0009733	P	response to auxin
GO:0009737	P	response to abscisic acid
GO:0009739	P	response to gibberellin
GO:0010199	P	organ boundary specification between lateral organs and the meristem
GO:0010200	P	response to chitin
GO:0016363	C	nuclear matrix
GO:0019760	P	glucosinolate metabolic process
GO:0046686	P	response to cadmium ion
GO:0042803	F	protein homodimerization activity
GO:0045165	P	cell fate commitment
GO:0045624	P	positive regulation of T-helper cell differentiation
GO:0045944	P	positive regulation of transcription from RNA polymerase II promoter
GO:0048527	P	lateral root development
GO:0048579	P	negative regulation of long-day photoperiodism, flowering
GO:0048765	P	root hair cell differentiation
GO:0051571	P	positive regulation of histone H3-K4 methylation
GO:0051574	P	positive regulation of histone H3-K9 methylation
GO:0051782	P	negative regulation of cell division
GO:0071367	P	cellular response to brassinosteroid stimulus
GO:0080060	P	integument development
GO:0080113	P	regulation of seed growth
GO:1901347	P	negative regulation of secondary cell wall biogenesis
GO:1901348	P	positive regulation of secondary cell wall biogenesis
GO:1902074	P	response to salt
GO:1904961	P	quiescent center organization
GO:2000022	P	regulation of jasmonic acid mediated signaling pathway
GO:2000031	P	regulation of salicylic acid mediated signaling pathway

KEGG pathway

KO	Name	Enzyme ID	Pathway	Pathway ID
K09422	MYBP; transcription factor MYB, plant	EC:-	-	-

Expression pattern in different tissues

Expression pattern in BioProjects

Co-expression network