result

Gene information

Detail information of AfisC6G05636

Location

Gene	Chr	Start	End	Strand
AfisC6G05636	chr6	990851018	990852050	-

Sequences

CDS

Protein

Gene

>AfisC6G05636
ATGAGCAAAAGAAAATTAGAGTTTCTCACAGAACTTATCAACGACTTTCATCTATGGGAACTTAATGGAGATCCATCGAGAGATCTAATATCATTGATCAAGTAAGTATCTACTGTAATTTGTTTGTATTCTGTTTCATTTACTGTTTTTTAAATGCTAATATGTAGGGTTGGCAATTTAGTCTAATATTAGTCTAATATCATAATGTGCTATTTTTATATTCTGGCATGTATTAGACTATCACTGTCCTATGGTTGACATTTTAGAATGTAAAAGAATGTTTGTTGACTGACTTGATACATATTAATGTTACGGTACTTGCTATTCGTTTCTATTTGTCAAGAGGGAAAACACCCACACATGTATCGGAATTGACTATGGTTGACATTTTAGAATGTAAAAGAATGTTTGTTGACTGACTTGATACATATTAATGTTAATCTACTTGCTATTCATTTCTATTTATAATTTTGTTCATAAGTAATCATAATTGGATTTTTTTTTTCTAGTGTTAGGTCACACCATTCTTGAGTATGGAAATTCTGTTTCCTATAAATGATTCCTCAAACTAACATTTTTTGATACTTTAATTTTTAGGTAATATTGAGATTACATAATTTGTCGGCTAAAATTGATAAAGTATTTATTAGTAGAAATATAGCGCTGCCTTAGCTGCTGCTGTGCCACACAGCAGCCTTAGCTGTTTTGCACTCATGTTTTTTAAATTTATACTAATTTAGGATGTTTGTTTGGATATTCAAGGAACATTTTTAACCAATACGATTTTGATATATTTGGAAAAAGTACTGTAAATAAAGTTGATTATATGGTATTTATACATTTATGTAGTTTTACCCATCTTTGTTAAATAAATTCTTATTTTTTGTAATTTAGGAACATTGTATCTGGACTATGTCACTTGCATACAAATAAGATTGTACATAGAGATCTGAAGCCCGGCAATGTATTGATTTTGTTTGAGAATGGTGATTTAATCCCCAAATTATCTGATATTGGGGTGAACAAGCATTGA

Functional annotation

Database	accession number	e-value	annotation
nr	KAF5735876.1	3.1e-12	putative Endoribonuclease/protein kinase IRE1-like
Swissprot	O75460.2	1.2e-05	Endoribonuclease
trEMBL	A0A7J7CPQ7	2.2e-12	Putative Endoribonuclease/protein kinase IRE1-like

Best hit in Arabidopsis

TAIR id	% identity	e-value	bit score	gene aliases	Short description
AT5G24360.1	55.56	2e-12	67.8	ATIRE1-1;AtIRE1b;IRE1-1;IRE1B	inositol requiring 1-1

>>>Show top 3 blast result

Query id	Subject id	alignment length	mis matches	gap openings	query start	query end	subject start	subject end	% identity	e-value	bit score
AfisC6G05636	AT5G24360.2	63	27	1	17	79	579	640	55.56	1e-12	67.8
AfisC6G05636	AT5G24360.1	63	27	1	17	79	573	634	55.56	2e-12	67.8
AfisC6G05636	AT5G24360.3	63	27	1	17	79	559	620	55.56	2e-12	67.8

Ortholog group

Species	Genes
-	-

Pfam domain

Pfam ID	Pfam name	type	alignment_start	alignment_end	bit_score	Evalue
PF00069.22	Pkinase	Domain	25	78	46.9	2e-12

Gene Ontology

Accession	Ontology	Name
GO:0000166	F	nucleotide binding
GO:0000394	P	RNA splicing, via endonucleolytic cleavage and ligation
GO:0005509	F	calcium ion binding
GO:0001757	P	somite specification
GO:0002223	P	stimulatory C-type lectin receptor signaling pathway
GO:0003676	F	nucleic acid binding
GO:0009615	P	response to virus
GO:0004521	F	endoribonuclease activity
GO:0004704	F	NF-kappaB-inducing kinase activity
GO:0004723	F	calcium-dependent protein serine/threonine phosphatase activity
GO:0006954	P	inflammatory response
GO:0006987	P	activation of signaling protein activity involved in unfolded protein response
GO:0007252	P	I-kappaB phosphorylation
GO:0007417	P	central nervous system development
GO:0007595	P	lactation
GO:0043066	P	negative regulation of apoptotic process
GO:0050830	P	defense response to Gram-positive bacterium
GO:0008384	F	IkappaB kinase activity
GO:0008385	C	IkappaB kinase complex
GO:0008630	P	intrinsic apoptotic signaling pathway in response to DNA damage
GO:0009751	P	response to salicylic acid
GO:0009816	P	defense response to bacterium, incompatible interaction
GO:0009898	C	cytoplasmic side of plasma membrane
GO:0010008	C	endosome membrane
GO:0010629	P	negative regulation of gene expression
GO:0010803	P	regulation of tumor necrosis factor-mediated signaling pathway
GO:0016605	C	PML body
GO:0018105	P	peptidyl-serine phosphorylation
GO:0050852	P	T cell receptor signaling pathway
GO:0030316	P	osteoclast differentiation
GO:0031625	F	ubiquitin protein ligase binding
GO:0031966	C	mitochondrial membrane
GO:0032480	P	negative regulation of type I interferon production
GO:0032727	P	positive regulation of interferon-alpha production
GO:0033598	P	mammary gland epithelial cell proliferation
GO:0034263	P	autophagy in response to ER overload
GO:0035456	P	response to interferon-beta
GO:0035631	C	CD40 receptor complex
GO:0035666	P	TRIF-dependent toll-like receptor signaling pathway
GO:0035994	P	response to muscle stretch
GO:0036435	F	K48-linked polyubiquitin binding
GO:0038061	P	NIK/NF-kappaB signaling
GO:0038095	P	Fc-epsilon receptor signaling pathway
GO:0042406	C	extrinsic component of endoplasmic reticulum membrane
GO:0042475	P	odontogenesis of dentin-containing tooth
GO:0042803	F	protein homodimerization activity
GO:0051260	P	protein homooligomerization
GO:0043123	P	positive regulation of I-kappaB kinase/NF-kappaB signaling
GO:0043124	P	negative regulation of I-kappaB kinase/NF-kappaB signaling
GO:0044565	P	dendritic cell proliferation
GO:0045359	P	positive regulation of interferon-beta biosynthetic process
GO:0045944	P	positive regulation of transcription from RNA polymerase II promoter
GO:0046777	P	protein autophosphorylation
GO:0046982	F	protein heterodimerization activity
GO:0051092	P	positive regulation of NF-kappaB transcription factor activity
GO:0051219	F	phosphoprotein binding
GO:0051403	P	stress-activated MAPK cascade
GO:0055113	P	epiboly involved in gastrulation with mouth forming second
GO:0060749	P	mammary gland alveolus development
GO:0070423	P	nucleotide-binding oligomerization domain containing signaling pathway
GO:0070530	F	K63-linked polyubiquitin binding
GO:0097110	F	scaffold protein binding
GO:1904417	P	positive regulation of xenophagy

KEGG pathway

KO	Name	Enzyme ID	Pathway	Pathway ID
-	-	-	-	-

Expression pattern in different tissues

Expression pattern in BioProjects

Co-expression network