result

Gene information

Detail information of g102283

Location

Gene	Chr	Start	End	Strand
g102283	Scaffold_38417:HRSCAF_421503	219037	221419	+

Sequences

CDS

Protein

Gene

>g102283.t1
ATGCAATCAGAAGAATCGCCTCCAAAGTGTTTGACTAAACCTTCAGCTGGAGTATATAACGATGGACGTGATAATGTTAACTTCGAACTCATCTTGCATGTTGATTCCGAGCTATTAAATCTTAAAACAAGGACAAGGTTTTATTCTTATCATTTTACAAAATAATAAAGCAAATATGCTACAACTTCATAAAAAAATTATTATTATTCCTTAATTTTTCTTCTTCTTTCTATTCCAGGTATGTAGTTAAAGGTTTCCTAGGCAAAAGGGTATATGGTCAAGTTGCAAAGTGTTTGGTGTTTTGTTGCTCTAAAATTTATAAAGAATCATGAAGCTTATAAGCAACAGGCACATGTTGAAGTGGGAATTCTAAACCATGTAAATGAGATGACTTGTACTTGTTTATTTATTTTTCCCATTTTATATTACTTTAATTTAATGGGTTTATTGTATGTAGCTGAAACAGAATTAAGTTGGGGCGAGAAGCGTCACATTGTTAGAATGAACGAATGGGTTGACTTCAAGGGACATGTCTGCATATCATGTGAACTACTTGGACCCAATCTGTAAGAAATTTACCATACTTTACTTCGTATAAATTTGTTGCTCCCTCTTTATTTTTTGTTCAAAGTTTTTGGCTTTTTGTGAGGTATTGGAAAGTGCTTTTTAATGTTTTTTCCTTCTTCTGAAGACTAGATTTAGAATCAATTACAGTAGATATTTACAATAAAGTTAGAGTTGATGAACCCATATGAGTTACTTTAATATTTGTGCATAATTAGTGTCATACAAAACGTTCATAATATATTTATACATTGAAAAATACTTATTCTGTACAAGCGTACTGGTTACTCCTTGTACTTTGTATAGAGTCCATTTTTACTCGTAGATACTTTTAAACATCAATTAATTATTAACCATCTCGAACATTAATTGCTCATTGAAAGAGAGGGAAATAATTAGGTAGTATTTCACCTGTAGTTTGGTCTTACTTTTTCCGTTTTGCAATCTAGGTATGAAAGAATGAAATATCACAAAAGATTGTCTCTAGATGATATCCGAACAATCTCAAAACAGGTAGTGTATATTTTGTCTAATTTTGTATACGTTTTTTGTTGTTGTGCCACACATATACGTTGCCTGATTTTATTGTCATTTTATATTGATGCATTTATAGATCTTACAAGGGTTGGTTGCCATAAAAAGAGCAGGTATTATCCATTGCGATCTGAAGCCAGAAAACATTCTTTTGTCTAGAAGGTATGCCCATCAAACATTCCAATGAAATATACATTTGAGCATGGATAATATAGAAGCTCCAAAAACTAAAAACAAAAATTCATTGATGGAGTATGAAACTGTGATCAAGTTTTAGAGTTTTAGAATGTTATCATCTTTTAGCTAAAATTTTATCAATATATATGTGTGAGACAAAAGGAAGATTGAATTAAAACATAAAGAGAAACGATTCAATTATATATACTGAATGGTTTGAATACTAACAACAACTAATGTTGCCCTAGATGAAATAAGCAGTACCCACAACAACTTCCTTTATAATAACAGTAAACAATTAAAGAAGAAGAAGATTGATGTGCATTTAAAAAATGTGATCCATGCAAACCCAGTTACAAACTGCAAGTTGAGTGTTATGTGATAAATTCCATCGGAAAAACTTTTGTAATTCTTATGTTCATTAATTGTTGGTATTATGTATAGTACACAAGTTTTCAACTTATCATTAGTAATCATGTGGTTTTCTGCTTTCACAGGGAAGATTCAGGTAGCTTGGAAATTAAAATAATCGACTTTGGATTAGAGTGCTTAGAGGATAAAATAGTACATTCCTACGTGCAAAGTAGATTCTACAGATCACCAGAAGTAGCTGTTGGTTTGAACTACATGTCCGCTATTGACACATGGTCATTTGGCTGTATTGTTGCTGAACTGTTCTTGGGCATTCCATTATTTCCTGCTTCTTCAAATGTTGATCTTGTCAAGAAGATACATGATATACTTTGGTATGTTAAACTATACAATATTCTTAGTCTTGCTATGGTTTACATTTTGTCGCATTTATTTTTTCAAAGTATATAATTTCTTTCAACATTACAGCAATCAATCTCCAGATGATCTTGCACGTTCAGCATGTGATCTTACTAAGAAGATGGTTGATGTACTTGGTTATGTTAAACACCAACATATTTCTTGCTATGACTTAAATTATATTGCATACATTTTATGTTAATTTTGAATACAAAATTTCTTTCCACATTTACAGTAATCACCCTCAAGATGGTTACTTTCAAAGACCGGCTGTCTTCAAGAACAACCACAGCAAGGCCAAGCTAGAGAAGATAATTATAGATCGTCCTTATGGTGA

Functional annotation

Database	accession number	e-value	annotation
nr	EEC73847.1	1.8e-46	hypothetical protein OsI_08603
Swissprot	Q8RWH3.1	3.6e-39	Dual specificity tyrosine-phosphorylation-regulated kinase YAK1
trEMBL	B8AH87	1.3e-46	Protein kinase domain-containing protein

Best hit in Arabidopsis

TAIR id	% identity	e-value	bit score	gene aliases	Short description
AT5G35980.1	54.37	4e-42	167	YAK1	yeast YAK1-related gene 1

>>>Show top 3 blast result

Query id	Subject id	alignment length	mis matches	gap openings	query start	query end	subject start	subject end	% identity	e-value	bit score
g102283	AT5G35980.1	160	66	3	37	194	203	357	54.37	4e-42	167
g102283	AT5G35980.2	160	66	3	37	194	203	357	54.37	4e-42	167
g102283	AT3G17750.1	173	98	3	47	213	914	1082	37.57	2e-22	102

Ortholog group

Species	Genes
-	-

Pfam domain

Pfam ID	Pfam name	type	alignment_start	alignment_end	bit_score	Evalue
PF00069.22	Pkinase	Domain	49	197	105.7	2.3e-30

Gene Ontology

Accession	Ontology	Name
GO:0005622	C	intracellular
GO:0005575	C	cellular_component
GO:0001101	P	response to acid chemical
GO:0008152	P	metabolic process
GO:0003674	F	molecular_function
GO:0003824	F	catalytic activity
GO:0005829	C	cytosol
GO:0004672	F	protein kinase activity
GO:0004674	F	protein serine/threonine kinase activity
GO:0004713	F	protein tyrosine kinase activity
GO:0007165	P	signal transduction
GO:0035556	P	intracellular signal transduction
GO:0005623	C	cell
GO:0005737	C	cytoplasm
GO:0005911	C	cell-cell junction
GO:0006464	P	cellular protein modification process
GO:0006468	P	protein phosphorylation
GO:0006793	P	phosphorus metabolic process
GO:0006796	P	phosphate-containing compound metabolic process
GO:0006807	P	nitrogen compound metabolic process
GO:0006935	P	chemotaxis
GO:0006950	P	response to stress
GO:0006970	P	response to osmotic stress
GO:0006972	P	hyperosmotic response
GO:0006979	P	response to oxidative stress
GO:0007154	P	cell communication
GO:0008150	P	biological_process
GO:0009267	P	cellular response to starvation
GO:0042493	P	response to drug
GO:0009506	C	plasmodesma
GO:0009605	P	response to external stimulus
GO:0009628	P	response to abiotic stimulus
GO:0009719	P	response to endogenous stimulus
GO:0009725	P	response to hormone
GO:0009737	P	response to abscisic acid
GO:0009787	P	regulation of abscisic acid-activated signaling pathway
GO:0009789	P	positive regulation of abscisic acid-activated signaling pathway
GO:0009892	P	negative regulation of metabolic process
GO:0009893	P	positive regulation of metabolic process
GO:0009966	P	regulation of signal transduction
GO:0009967	P	positive regulation of signal transduction
GO:0009987	P	cellular process
GO:0009991	P	response to extracellular stimulus
GO:0010033	P	response to organic substance
GO:0010468	P	regulation of gene expression
GO:0010604	P	positive regulation of macromolecule metabolic process
GO:0010605	P	negative regulation of macromolecule metabolic process
GO:0010628	P	positive regulation of gene expression
GO:0010629	P	negative regulation of gene expression
GO:0010646	P	regulation of cell communication
GO:0010647	P	positive regulation of cell communication
GO:0014070	P	response to organic cyclic compound
GO:0016301	F	kinase activity
GO:0016310	P	phosphorylation
GO:0016740	F	transferase activity
GO:0016772	F	transferase activity, transferring phosphorus-containing groups
GO:0016773	F	phosphotransferase activity, alcohol group as acceptor
GO:0046677	P	response to antibiotic
GO:0018108	P	peptidyl-tyrosine phosphorylation
GO:0018193	P	peptidyl-amino acid modification
GO:0018212	P	peptidyl-tyrosine modification
GO:0019222	P	regulation of metabolic process
GO:0019538	P	protein metabolic process
GO:0019932	P	second-messenger-mediated signaling
GO:0019933	P	cAMP-mediated signaling
GO:0019935	P	cyclic-nucleotide-mediated signaling
GO:0033554	P	cellular response to stress
GO:0023052	P	signaling
GO:0023051	P	regulation of signaling
GO:0023056	P	positive regulation of signaling
GO:0030054	C	cell junction
GO:0030587	P	sorocarp development
GO:0031152	P	aggregation involved in sorocarp development
GO:0031667	P	response to nutrient levels
GO:0031668	P	cellular response to extracellular stimulus
GO:0031669	P	cellular response to nutrient levels
GO:0032502	P	developmental process
GO:0033993	P	response to lipid
GO:0036211	P	protein modification process
GO:0040011	P	locomotion
GO:0042221	P	response to chemical
GO:0042330	P	taxis
GO:0042594	P	response to starvation
GO:0043170	P	macromolecule metabolic process
GO:0043412	P	macromolecule modification
GO:0044237	P	cellular metabolic process
GO:0044238	P	primary metabolic process
GO:0044260	P	cellular macromolecule metabolic process
GO:0044267	P	cellular protein metabolic process
GO:0044424	C	intracellular part
GO:0044444	C	cytoplasmic part
GO:0044464	C	cell part
GO:0044764	P	multi-organism cellular process
GO:0045472	P	response to ether
GO:0046777	P	protein autophosphorylation
GO:0048518	P	positive regulation of biological process
GO:0048519	P	negative regulation of biological process
GO:0048522	P	positive regulation of cellular process
GO:0048583	P	regulation of response to stimulus
GO:0048584	P	positive regulation of response to stimulus
GO:0048856	P	anatomical structure development
GO:0050789	P	regulation of biological process
GO:0050794	P	regulation of cellular process
GO:0050896	P	response to stimulus
GO:0051409	P	response to nitrosative stress
GO:0051703	P	intraspecies interaction between organisms
GO:0051704	P	multi-organism process
GO:0051716	P	cellular response to stimulus
GO:0055044	C	symplast
GO:0060255	P	regulation of macromolecule metabolic process
GO:0065007	P	biological regulation
GO:0071496	P	cellular response to external stimulus
GO:0071704	P	organic substance metabolic process
GO:0097305	P	response to alcohol
GO:0097327	P	response to antineoplastic agent
GO:0098630	P	aggregation of unicellular organisms
GO:0098743	P	cell aggregation
GO:1901419	P	regulation of response to alcohol
GO:1901421	P	positive regulation of response to alcohol
GO:1901564	P	organonitrogen compound metabolic process
GO:1901654	P	response to ketone
GO:1901700	P	response to oxygen-containing compound
GO:1904643	P	response to curcumin
GO:0090702
GO:0099120
GO:0140096
GO:1905957
GO:1905959

KEGG pathway

KO	Name	Enzyme ID	Pathway	Pathway ID
K18670	YAK1; dual specificity protein kinase YAK1	EC:2.7.12.1	-	-

Expression pattern in different tissues

Expression pattern in BioProjects

Co-expression network