result

Gene information

Detail information of g111467

Location

Gene	Chr	Start	End	Strand
g111467	Scaffold_39445:HRSCAF_422531	421527	422723	+

Sequences

CDS

Protein

Gene

>g111467.t1
ATGAACACCATTTTCTCCCCACAACTAACAAAACCGGACCCATTCATAGGAACCCACCACCGCCGTGCCCATTCCCACGATCCTTACAGGATCGCTGACATCAACCCTGGACCCCGTAACCTGTTAATGGACGATTTTGGGTCAGATGATGACCTCTTCCACATGTATTTAGACATGGAGAAGGTCGGTTCTGGGTGCCAAGAAGAAGGCGATCCGGTAAAGAAAACCAAGCACGGGCAAAGTCTCTCGGTTGGTGGGTTCGGGTACGGGTCCATAGAGGCTAAAAAGGCCATGGCTCCTGAAAAACTAGCCGAGCTTGCCGTCGTGGACCCTAAAAGAGCCAAACGGTAAAATAGTTTGTCTTTTATACAAATACTTACGTATGAATTCATGCACCATATTGGTATTCAACTTAATACATATGGATGCATGCAGAATTATAGCCAACAGGCAGTCAGCTGCAAGGTCAAAAGAAAGAAAGGCACGTTACATTTCGGAACTGGAAAGAAAAGTTCAGACTCTTCAAATCGAACTCGCTACCCTTTCTGCACAACACTCTCTTCTTCAGGTTTTCTGTTTTATTCTTCTTCGAATTACTTGACTTATGCTTCAGTTGTATTATGCTAAGAGAATCATATTATTCATTAGAGAGATATTACTAGTTTAGCTGCTGAAAACAATGAACTTAAGTTGCGGCTACAAGCTATGGAGCAACAAGCTCAACTGCATGAAGGTGATAATTTCTTCAAATATTCATATCTGATGCATAATTTATTAGAAATATTCATTATGTTAAGGATTTTGTGTGCAGCGTTGAATGAGGCTCTGAAGAACGAAGTGGAGAGACTGAAATACGCAACAGGAGATGTACAAAATCCTTCTAGTACATGCAACATTTCACTGCAGCAAATACAACTAAATGAATCTTTTCATTCGCGTACACAAAATCAACATCATCATCATCATCAGCAGCAACAGCTTAGTTTTCATCAGCCTGTTCAACAGTCGCAGCAAATGCTTTCTAGTTGTCATATGGTCGATAGGAACCATAATCAGAATATGCGTGAAATTTCAAGTGTAACGATGATGCCGCAAGATCAGATTGTGTTGGTTAATGAACTAGATTTTAACAGTGAGCCTCAAATTGTACAACCTGAAAGCTTGACCGCTTCTCCAACTGATGAAAGCAGCAATTGA

Functional annotation

Database	accession number	e-value	annotation
nr	XP_013636912.1	7.1e-52	PREDICTED: transcription factor RF2b-like
Swissprot	Q6S4P4.2	1.6e-53	Transcription factor RF2b
trEMBL	A0A0D3BNY4	5.1e-52	BZIP domain-containing protein

Best hit in Arabidopsis

TAIR id	% identity	e-value	bit score	gene aliases	Short description
AT2G40620.1	51.75	3e-61	231		Basic-leucine zipper (bZIP) transcription factor family protein

>>>Show top 3 blast result

Query id	Subject id	alignment length	mis matches	gap openings	query start	query end	subject start	subject end	% identity	e-value	bit score
g111467	AT2G40620.1	286	101	7	12	271	26	300	51.75	3e-61	231
g111467	AT1G06850.1	179	70	3	81	254	117	294	57.54	2e-46	182
g111467	AT1G06070.1	271	91	7	20	236	73	334	43.17	2e-45	179

Ortholog group

Species	Genes
Allium cepa	g111467.t1
Allium fistulosum	AfisC4G06852
Allium sativum
Arabidopsis thaliana
Oryza sativa

Pfam domain

Pfam ID	Pfam name	type	alignment_start	alignment_end	bit_score	Evalue
PF00170.18	bZIP_1	Family	112	170	35.7	6.3e-09

Gene Ontology

Accession	Ontology	Name
GO:0005515	F	protein binding
GO:0005622	C	intracellular
GO:0005575	C	cellular_component
GO:0003674	F	molecular_function
GO:0003700	F	transcription factor activity, sequence-specific DNA binding
GO:0005488	F	binding
GO:0005623	C	cell
GO:0005634	C	nucleus
GO:0005737	C	cytoplasm
GO:0005654	C	nucleoplasm
GO:0043231	C	intracellular membrane-bounded organelle
GO:0006355	P	regulation of transcription, DNA-templated
GO:0008150	P	biological_process
GO:0009889	P	regulation of biosynthetic process
GO:0010468	P	regulation of gene expression
GO:0010556	P	regulation of macromolecule biosynthetic process
GO:0019219	P	regulation of nucleobase-containing compound metabolic process
GO:0019222	P	regulation of metabolic process
GO:0031323	P	regulation of cellular metabolic process
GO:0031326	P	regulation of cellular biosynthetic process
GO:0031974	C	membrane-enclosed lumen
GO:0031981	C	nuclear lumen
GO:0043226	C	organelle
GO:0043227	C	membrane-bounded organelle
GO:0043229	C	intracellular organelle
GO:0043233	C	organelle lumen
GO:0043621	F	protein self-association
GO:0044422	C	organelle part
GO:0044424	C	intracellular part
GO:0044428	C	nuclear part
GO:0044444	C	cytoplasmic part
GO:0044446	C	intracellular organelle part
GO:0044464	C	cell part
GO:0048471	C	perinuclear region of cytoplasm
GO:0050789	P	regulation of biological process
GO:0050794	P	regulation of cellular process
GO:0051171	P	regulation of nitrogen compound metabolic process
GO:0051252	P	regulation of RNA metabolic process
GO:0060255	P	regulation of macromolecule metabolic process
GO:0065007	P	biological regulation
GO:0070013	C	intracellular organelle lumen
GO:0080090	P	regulation of primary metabolic process
GO:1903506	P	regulation of nucleic acid-templated transcription
GO:2000112	P	regulation of cellular macromolecule biosynthetic process
GO:2001141	P	regulation of RNA biosynthetic process
GO:0140110

KEGG pathway

KO	Name	Enzyme ID	Pathway	Pathway ID
-	-	-	-	-

Expression pattern in different tissues

Expression pattern in BioProjects

Co-expression network