result

Gene information

Detail information of g112446

Location

Gene	Chr	Start	End	Strand
g112446	Scaffold_39564:HRSCAF_422650	56526	57872	-

Sequences

CDS

>g112446.t1
ATGTTAGGATACCGGGTTTTTCAAACTTTTCATCCGTCTCGCCAAATAATAACACCTATGGACAGAGGTCATGATCCAGTTTTCACCACTTCTCAATTAGTTCAACCAATCGAGGAGGAAGAAGAAGAATTCGATTTGAATTCAAATACAAGCGAAGAAGGTTCAGCATTTTCACCAAATGAAGATTTTTTTCATGCCACAACCCAAACAGAGAATCAAGCTCTTGAGCTTTTGAGTTTGCTTTCACTCTGTGCAGAATCTATCAGCATGGAAAATCATGCAGCTATAAATTGCTTCCTTTCTAGACTAGGAGAGCTCGCTTCGCCCAGAGGCTCAACTATTCAAAGACTAGTAGCATATTTTGCAGAAGCATTAGCATTGCGAGTAGTCAAACTCTTTCCTCGTATCTTTTCTATTTCACCTCCTAGAGACATAAGCGATGAAATTGACTATGAAGATGATTGCCTAGCACTTAGAATTCTCAACCATGTTAGCCCAATTCAAAAGTTCATACATTTCACTATCAACGAGAGACTACTCAAAGCATTTGAAGGAAAAGATAGAGTTCATATCATAGATTTTGACGTAAAAGAAGGCATCCAGTGGCCAAGTCTACTTCAAAGCTTAGCTTCTAGGCCAAACCCTCCAACTCAAGTTCGTATCACTGGCATCGGGGATTCAAGGCAAAATTTGCAAGAAACGGGCAATAGACTTAAACACATAGCAGAGTCACTGCATTTGCAATTCGAATTCCATTGTGTGGTGGATCGTTTAGAAGATGTGAGGCTTTGGATGCTTCATGTGAAAGACGGAGAATGTGTAGGCGTAAATTGCATATCTCAACTGCATAAAACACTATACAATGAGAATCAAAGTGGTCTTATGAACCTACTTGCTTTGATTAGAAGCACAAATCCTTCTATTCTTTTAGTGGCGGAGGAAGAAGCAGAGCATAATGATCCTAGGTGGGAAGTGAGGTTCGGTAATGCATTGAAGTATTACTCTGCTATATTTGATTCTCTGGATGCTAATTTCTTGCATGAAGATAGTATTTTGAGGCTGAAGGTTGAAGAAATGTTTGGAAGAAGAATAAGAAATATAGTTTCTTGTGAAGGAGATGAAAGAATGGAGAGGCATGAGAGATTTGAGAAATGGAGGGAGATGATTGAAGGTTGTGGATTTAAAAGTTTAGAACTTGGTGAGAATGAAGAGATGCAAAGTAGGCTGATTTTGAAGATGTATTCGAGTGGGGAAGATTATGATGTGAAGAAGGAAGAAGGTGGGCTTAAGATGAAGTGGTTTGATCAAGCTTTATACACGGTTTCGGCATGGGAGATGACTAGTTGA

Protein

Gene

Functional annotation

Database	accession number	e-value	annotation
nr	XP_020241359.1	4.1e-162	protein DWARF AND LOW-TILLERING-like
Swissprot	Q9CAN3.1	4.6e-118	GRAS family protein 8
trEMBL	A0A8N4IBZ7	4.9e-141	protein DWARF AND LOW-TILLERING

Best hit in Arabidopsis

TAIR id	% identity	e-value	bit score	gene aliases	Short description
AT1G63100.1	56.25	2e-120	429		GRAS family transcription factor

>>>Show top 3 blast result

Query id	Subject id	alignment length	mis matches	gap openings	query start	query end	subject start	subject end	% identity	e-value	bit score
g112446	AT1G63100.1	384	152	6	75	444	272	653	56.25	2e-120	429
g112446	AT2G01570.1	389	223	9	70	448	214	584	35.48	4e-67	252
g112446	AT1G14920.1	386	233	6	70	448	162	532	33.94	3e-66	249

Ortholog group

Species	Genes
Allium cepa	g112446.t1; g80692.t1
Allium fistulosum	AfisC2G04815; AfisC2G04816; AfisC2G05712; AfisC2G07833
Allium sativum	Asa4G03717.1; Asa5G03354.1; Asa5G03646.1; Asa6G03174.1
Arabidopsis thaliana	AT1G63100.1
Oryza sativa	LOC_Os03g37900.1; LOC_Os06g03710.1

Pfam domain

Pfam ID	Pfam name	type	alignment_start	alignment_end	bit_score	Evalue
PF03514.11	GRAS	Family	78	445	407.6	4.2e-122

Gene Ontology

Accession	Ontology	Name
GO:0005622	C	intracellular
GO:0005575	C	cellular_component
GO:0003674	F	molecular_function
GO:0003676	F	nucleic acid binding
GO:0003677	F	DNA binding
GO:0003700	F	transcription factor activity, sequence-specific DNA binding
GO:0005488	F	binding
GO:0005623	C	cell
GO:0005634	C	nucleus
GO:0043231	C	intracellular membrane-bounded organelle
GO:0006355	P	regulation of transcription, DNA-templated
GO:0008150	P	biological_process
GO:0009889	P	regulation of biosynthetic process
GO:0009966	P	regulation of signal transduction
GO:0009967	P	positive regulation of signal transduction
GO:0010468	P	regulation of gene expression
GO:0010556	P	regulation of macromolecule biosynthetic process
GO:0010646	P	regulation of cell communication
GO:0010647	P	positive regulation of cell communication
GO:0019219	P	regulation of nucleobase-containing compound metabolic process
GO:0019222	P	regulation of metabolic process
GO:0023051	P	regulation of signaling
GO:0023056	P	positive regulation of signaling
GO:0031323	P	regulation of cellular metabolic process
GO:0031326	P	regulation of cellular biosynthetic process
GO:0043226	C	organelle
GO:0043227	C	membrane-bounded organelle
GO:0043229	C	intracellular organelle
GO:0043565	F	sequence-specific DNA binding
GO:0044424	C	intracellular part
GO:0044464	C	cell part
GO:0048518	P	positive regulation of biological process
GO:0048522	P	positive regulation of cellular process
GO:0048583	P	regulation of response to stimulus
GO:0048584	P	positive regulation of response to stimulus
GO:0050789	P	regulation of biological process
GO:0050794	P	regulation of cellular process
GO:0051171	P	regulation of nitrogen compound metabolic process
GO:0051252	P	regulation of RNA metabolic process
GO:0060255	P	regulation of macromolecule metabolic process
GO:0065007	P	biological regulation
GO:0080090	P	regulation of primary metabolic process
GO:0097159	F	organic cyclic compound binding
GO:1900457	P	regulation of brassinosteroid mediated signaling pathway
GO:1900459	P	positive regulation of brassinosteroid mediated signaling pathway
GO:1901363	F	heterocyclic compound binding
GO:1903506	P	regulation of nucleic acid-templated transcription
GO:2000112	P	regulation of cellular macromolecule biosynthetic process
GO:2001141	P	regulation of RNA biosynthetic process
GO:0140110

KEGG pathway

KO	Name	Enzyme ID	Pathway	Pathway ID
-	-	-	-	-

Expression pattern in different tissues

Expression pattern in BioProjects

Co-expression network