result

Gene information

Detail information of g127636

Location

Gene	Chr	Start	End	Strand
g127636	Scaffold_41499:HRSCAF_424585	140005	141639	-

Sequences

CDS

Protein

Gene

>g127636.t1
ATGGACATGATGCTTGTGAAAAGTGAAATGCTGAATGAAAATAGAAGGAGAGTTCTAGGAGTGACTGCTGCTGCTTCTAGTGAAGTGAAACAAATTAAGAGGCGGAGAAGAGAGTCTGCATTGCCTGCTGTGGTAACAGCAGGCAGTAACAAAGATGGAATAGTAGAGCAGACAACTGGTACCACCATTAAACGGAGCTCTAGGTTTCGGGGTGTTAGCAGGTAATTAATTAGCCTATAAATATATTTCTTTAAGTAAGTGAATGGATATTAACATTTAAAGCATACGATTAATATCAGGCATCGATGGACTGGTCGATATGAAGCACATTTATGGGACAAAGGGTCATGGAATGCAACACAAAGGAAGAAAGGAAAACAAGGTACATTCTCAATCCTATCACTAAACTCAACGTATGATGCAATGTATAATATATGTGATGGAAAAATTGCATTTTAGTTTATCTTGGTGCATATGATGAGGAAGAATCAGCTGCAAGAGCTTATGACCTTGCTGCTCTCAAATACTGGGGACCTACCACCTTCACAAATTTCCCTGTATGTAGTTTAGTTTAACTCAACTTTGCTTCACTACGTGATTTCATATAAATCAAAATGCTTCAATTATTTCAGGTGACAGACTATGAGAAGGAAATTGAAATAATGCAGACTGTTACCAAAGAAGAGTACCTAGCTTCCTTGAGAAGGTATGATAGATTATGATTAATATTCTGCAACAACTGAACATTATTCAAGCACTTTAGACTTTAGCTCTTGCTGGCTTCATGTATCCTTCAAGGTTTCTGAATCTTAACATAAATGTTCATAGGAAAAGTAGTGGCTTCTCAAGAGGAGTATCAAAGTATAGAGGAGTTGCAAGGTTGCTGTTAATCAAAATTATTCTTAAATTATTGTTGGAGATGATTTTTTTACTAAAAAGAAAATTTGTTATGAACTCAACGACAGGCATCATCATAATGGAAGATGGGAAGCAAGAATAGGACGAGTTTTTGGGAACAAATATCTCTACCTTGGAACATACAGTAAGCAAGCTAGCTAAACAAAAGACATATAACAGAATTTTATATATATCAAATTTGAATAAATATTCGAACCAGGTACTCAGGAAGAAGCTGCACATGCATACGACATTGCAGCAATAGAGTACAGAGGAATCAATGCAGTGACCAACTTCGACTTAAGCACATACATTAGATGGTTAAGACCTGGATCTACAACCAACAATATAAACATAAACCTACAGGAGCAGAACCAGAACAGTGCCTTACAGTTTCACACTACCCTACAACCATCCAATCATTTCCCTACAAACGTAGACCCTCAACCACCACTACCGATACAAAGAACTTTCCAGTTAGAAGACTTGCAAGTGCCATGCAAGCAAGAGTTTGTTTCTCTTCAAGCTCAAGGCAGCAAGTCATCTCCTACTGCTTTGAGTCTTCTGCTTAGGTCCTCTGTGTTTCAACAACTAGTTGAGAAGAATTCTAATGCTAGGGAAGAGGAAGAGAGTAACAATGGATTGATGTATGAAGGGATAGAGATTGAAGAGAGTGATAATGTGTATTATGAGAAGAACGATGGTGGTATTTGGAATGGTGTTATGGGTATTCAGTAG

Functional annotation

Database	accession number	e-value	annotation
nr	XP_020242611.1	2.2e-129	LOW QUALITY PROTEIN: AP2-like ethylene-responsive transcription factor At1g79700
Swissprot	Q6X5Y6.1	3.0e-78	Protein WRINKLED 1
trEMBL	A0A6J0PJQ0	3.1e-117	AP2-like ethylene-responsive transcription factor At1g16060

Best hit in Arabidopsis

TAIR id	% identity	e-value	bit score	gene aliases	Short description
AT3G54320.1	78.89	4e-78	288	ASML1;ATWRI1;WRI;WRI1	Integrase-type DNA-binding superfamily protein

>>>Show top 3 blast result

Query id	Subject id	alignment length	mis matches	gap openings	query start	query end	subject start	subject end	% identity	e-value	bit score
g127636	AT3G54320.3	180	38	0	58	237	55	234	78.89	3e-78	288
g127636	AT3G54320.1	180	38	0	58	237	55	234	78.89	4e-78	288
g127636	AT1G51190.1	219	79	2	19	232	136	354	61.64	7e-75	277

Ortholog group

Species	Genes
Allium cepa	g127636.t1; g22438.t1; g46163.t1
Allium fistulosum	AfisC2G02040; AfisC2G02046; AfisC4G00860; AfisC5G06269
Allium sativum	Asa4G00677.1; Asa4G05189.1; Asa4G05196.1
Arabidopsis thaliana	AT1G16060.2; AT1G79700.2
Oryza sativa	LOC_Os06g05340.1

Pfam domain

Pfam ID	Pfam name	type	alignment_start	alignment_end	bit_score	Evalue
PF00847.17	AP2	Domain	67	126	47.1	1.9e-12
PF00847.17	AP2	Domain	169	220	44.6	1.1e-11

Gene Ontology

Accession	Ontology	Name
GO:0008152	P	metabolic process
GO:0003674	F	molecular_function
GO:0003676	F	nucleic acid binding
GO:0003677	F	DNA binding
GO:0003700	F	transcription factor activity, sequence-specific DNA binding
GO:0005488	F	binding
GO:0006109	P	regulation of carbohydrate metabolic process
GO:0006110	P	regulation of glycolytic process
GO:0006140	P	regulation of nucleotide metabolic process
GO:0006355	P	regulation of transcription, DNA-templated
GO:0006629	P	lipid metabolic process
GO:0006638	P	neutral lipid metabolic process
GO:0006639	P	acylglycerol metabolic process
GO:0006641	P	triglyceride metabolic process
GO:0008150	P	biological_process
GO:0008610	P	lipid biosynthetic process
GO:0009058	P	biosynthetic process
GO:0009743	P	response to carbohydrate
GO:0009744	P	response to sucrose
GO:0009889	P	regulation of biosynthetic process
GO:0009891	P	positive regulation of biosynthetic process
GO:0009893	P	positive regulation of metabolic process
GO:0009894	P	regulation of catabolic process
GO:0009987	P	cellular process
GO:0010033	P	response to organic substance
GO:0010468	P	regulation of gene expression
GO:0010556	P	regulation of macromolecule biosynthetic process
GO:0010557	P	positive regulation of macromolecule biosynthetic process
GO:0010604	P	positive regulation of macromolecule metabolic process
GO:0019219	P	regulation of nucleobase-containing compound metabolic process
GO:0019220	P	regulation of phosphate metabolic process
GO:0019222	P	regulation of metabolic process
GO:0019432	P	triglyceride biosynthetic process
GO:0051196	P	regulation of coenzyme metabolic process
GO:0030808	P	regulation of nucleotide biosynthetic process
GO:0030811	P	regulation of nucleotide catabolic process
GO:0031323	P	regulation of cellular metabolic process
GO:0031326	P	regulation of cellular biosynthetic process
GO:0031329	P	regulation of cellular catabolic process
GO:0034285	P	response to disaccharide
GO:0042221	P	response to chemical
GO:0042325	P	regulation of phosphorylation
GO:0043467	P	regulation of generation of precursor metabolites and energy
GO:0043470	P	regulation of carbohydrate catabolic process
GO:0044237	P	cellular metabolic process
GO:0044238	P	primary metabolic process
GO:0044249	P	cellular biosynthetic process
GO:0044255	P	cellular lipid metabolic process
GO:0045017	P	glycerolipid biosynthetic process
GO:0046460	P	neutral lipid biosynthetic process
GO:0046463	P	acylglycerol biosynthetic process
GO:0046486	P	glycerolipid metabolic process
GO:0048518	P	positive regulation of biological process
GO:0050789	P	regulation of biological process
GO:0050794	P	regulation of cellular process
GO:0050896	P	response to stimulus
GO:0051171	P	regulation of nitrogen compound metabolic process
GO:0051174	P	regulation of phosphorus metabolic process
GO:0051193	P	regulation of cofactor metabolic process
GO:0051252	P	regulation of RNA metabolic process
GO:0060255	P	regulation of macromolecule metabolic process
GO:0065007	P	biological regulation
GO:0071704	P	organic substance metabolic process
GO:0080090	P	regulation of primary metabolic process
GO:0097159	F	organic cyclic compound binding
GO:1900371	P	regulation of purine nucleotide biosynthetic process
GO:1900542	P	regulation of purine nucleotide metabolic process
GO:1901363	F	heterocyclic compound binding
GO:1901576	P	organic substance biosynthetic process
GO:1901700	P	response to oxygen-containing compound
GO:1901957	P	regulation of cutin biosynthetic process
GO:1901959	P	positive regulation of cutin biosynthetic process
GO:1903506	P	regulation of nucleic acid-templated transcription
GO:1903578	P	regulation of ATP metabolic process
GO:2000112	P	regulation of cellular macromolecule biosynthetic process
GO:2001141	P	regulation of RNA biosynthetic process
GO:2001169	P	regulation of ATP biosynthetic process
GO:0062012
GO:0140110

KEGG pathway

KO	Name	Enzyme ID	Pathway	Pathway ID
K09285	OVM, ANT; AP2-like factor, ANT lineage	EC:-	-	-

Expression pattern in different tissues

Expression pattern in BioProjects

Co-expression network