result

Gene information

Detail information of g127991

Location

Gene	Chr	Start	End	Strand
g127991	CHR6	33314374	33315432	+

Sequences

CDS

Protein

Gene

>g127991.t1
ATGTGCATGTCGTACCACACCATCCCTCATCCTCTTCCACGTGTCCCACCTACGTAAAACGACATCAATCAATCCCCACCGTTCATCCCTCACCTCCTTCCTCCATCCAACGTTTCGCATTCCATCCGTTAATAAAGAAGCTCCACCGCCTTATAAATTGCTAACTCCGTCAGTTACTTCACTACTCCTCTTCTATTTAAATTCTCTTCTTCCCACATTTCCTTTTCACTTACAGCTGCCTCTCGATTTCAAACTCTCACTGATACCATGATGATGAACCAAAAGCCGTCGATTTACATTCCTACGGCTTATCTCGACGACATCGAGTACTTCTACGACTCCGACGATGAGTCATCCTTGGATCTGACCAGCACCGACGAGTTCCGGATGTACGAGTTCAAGATCCGCCGCTGCGGACGCGCGCGCTCACATGACTGGACAGAGTGCCCCTTCGCTCATCCCGGCGAGAAGGCGAAACGGAGAGATCCGAGGAAGTTTCACTACTCAGGTACCTCCTGCCCTGATTTCCGTAAAGGCAACTGCAAGCGAGGCGATTCGTGCGATATGTCGCACGGAGTGTTTGAATGCTGGCTCCATCCTGCTAGGTACAGGACTCAGCCTTGCAAGGACGGCGTAGCGTGTAGAAGAAGGGTTTGCTTCTTCGCTCATACGCCGGAGCAGTTGAGGGTCCTGCCGACGAGTCCGAAGACGGTGTTGGAAGGCTACGACGGATCGCCGATGAGGAGGGCGGTCACGTCCCCGGATAGTTCGCCGTTGCTCTCTCCAGTGATTGCTGGTTTGAGGAGGTTGCAGCTCGATAAAGTGAAATCGATGTCGAGCTCGTGTCCGAGTTCGAGCTATTTGGGGATGAGGTTTGGCGATGCGTTCTGTAGCGTGCCGACCACCCCTACAGCGGTTGATTACGATGAGAACGAAGGGTTTGTTGAAAGAGTCGAGAGCGGGAGGGCTTTGAGGATGAAGTTGTACGAGAGGTTGAGCAAGGAGAACTGTACCGTGGAGAAGAAGGATTCTGATGCAGATCCTGTTTGGTTTAATTAA

Functional annotation

Database	accession number	e-value	annotation
nr	XP_020580576.1	5.2e-79	zinc finger CCCH domain-containing protein 2-like
Swissprot	O82199.1	2.0e-72	Zinc finger CCCH domain-containing protein 20
trEMBL	A0A5J6NB87	1.6e-77	Zinc finger CCCH domain-containing protein 2-like isoform X1

Best hit in Arabidopsis

TAIR id	% identity	e-value	bit score	gene aliases	Short description
AT2G19810.1	52.42	7e-68	254	AtOZF1;AtTZF2;OZF1;TZF2	CCCH-type zinc finger family protein

>>>Show top 3 blast result

Query id	Subject id	alignment length	mis matches	gap openings	query start	query end	subject start	subject end	% identity	e-value	bit score
g127991	AT2G19810.1	269	83	4	74	297	65	333	52.42	7e-68	254
g127991	AT4G29190.1	329	133	10	10	297	10	330	44.68	2e-65	246
g127991	AT2G25900.2	235	81	5	81	296	84	312	54.89	5e-64	241

Ortholog group

Species	Genes
Allium cepa	g127991.t1; g156857.t1; g298224.t1
Allium fistulosum	AfisC6G06191; AfisC7G02453; AfisC8G02051
Allium sativum	Asa3G02945.1; Asa3G02947.1; Asa8G01139.1
Arabidopsis thaliana	AT2G19810.1; AT2G25900.1; AT2G25900.2; AT4G29190.1
Oryza sativa	LOC_Os01g09620.1; LOC_Os01g09620.2

Pfam domain

Pfam ID	Pfam name	type	alignment_start	alignment_end	bit_score	Evalue
-	-	-	-	-	-	-

Gene Ontology

Accession	Ontology	Name
GO:0005886	C	plasma membrane
GO:0005622	C	intracellular
GO:0005575	C	cellular_component
GO:0001101	P	response to acid chemical
GO:0003674	F	molecular_function
GO:0003700	F	transcription factor activity, sequence-specific DNA binding
GO:0016020	C	membrane
GO:0007165	P	signal transduction
GO:0005488	F	binding
GO:0046872	F	metal ion binding
GO:0005623	C	cell
GO:0005634	C	nucleus
GO:0043231	C	intracellular membrane-bounded organelle
GO:0006355	P	regulation of transcription, DNA-templated
GO:0006950	P	response to stress
GO:0006979	P	response to oxidative stress
GO:0007154	P	cell communication
GO:0007275	P	multicellular organism development
GO:0007568	P	aging
GO:0008150	P	biological_process
GO:0008270	F	zinc ion binding
GO:0009719	P	response to endogenous stimulus
GO:0009725	P	response to hormone
GO:0009753	P	response to jasmonic acid
GO:0009755	P	hormone-mediated signaling pathway
GO:0009867	P	jasmonic acid mediated signaling pathway
GO:0009889	P	regulation of biosynthetic process
GO:0009987	P	cellular process
GO:0010033	P	response to organic substance
GO:0010150	P	leaf senescence
GO:0010468	P	regulation of gene expression
GO:0010556	P	regulation of macromolecule biosynthetic process
GO:0019219	P	regulation of nucleobase-containing compound metabolic process
GO:0019222	P	regulation of metabolic process
GO:0023052	P	signaling
GO:0070887	P	cellular response to chemical stimulus
GO:0031323	P	regulation of cellular metabolic process
GO:0031326	P	regulation of cellular biosynthetic process
GO:0032501	P	multicellular organismal process
GO:0032502	P	developmental process
GO:0032870	P	cellular response to hormone stimulus
GO:0042221	P	response to chemical
GO:0043167	F	ion binding
GO:0043169	F	cation binding
GO:0043226	C	organelle
GO:0043227	C	membrane-bounded organelle
GO:0043229	C	intracellular organelle
GO:0044424	C	intracellular part
GO:0044464	C	cell part
GO:0046914	F	transition metal ion binding
GO:0048366	P	leaf development
GO:0048367	P	shoot system development
GO:0048731	P	system development
GO:0048827	P	phyllome development
GO:0048856	P	anatomical structure development
GO:0050789	P	regulation of biological process
GO:0050794	P	regulation of cellular process
GO:0050896	P	response to stimulus
GO:0051171	P	regulation of nitrogen compound metabolic process
GO:0051252	P	regulation of RNA metabolic process
GO:0051716	P	cellular response to stimulus
GO:0060255	P	regulation of macromolecule metabolic process
GO:0065007	P	biological regulation
GO:0071229	P	cellular response to acid chemical
GO:0071310	P	cellular response to organic substance
GO:0071395	P	cellular response to jasmonic acid stimulus
GO:0071495	P	cellular response to endogenous stimulus
GO:0071944	C	cell periphery
GO:0080090	P	regulation of primary metabolic process
GO:0099402	P	plant organ development
GO:1901700	P	response to oxygen-containing compound
GO:1901701	P	cellular response to oxygen-containing compound
GO:1903506	P	regulation of nucleic acid-templated transcription
GO:2000112	P	regulation of cellular macromolecule biosynthetic process
GO:2001141	P	regulation of RNA biosynthetic process
GO:0090693
GO:0140110

KEGG pathway

KO	Name	Enzyme ID	Pathway	Pathway ID
-	-	-	-	-

Expression pattern in different tissues

Expression pattern in BioProjects

Co-expression network