result

Gene information

Detail information of g128746

Location

Gene	Chr	Start	End	Strand
g128746	Scaffold_41642:HRSCAF_424728	198016	199440	+

Sequences

CDS

>g128746.t1
ATGGTGCAAGACGAAGCATCATCTTCGGTCACTTCATCTCCTCTTCAACATTTTTCGCTAATGTCACTCTCTCCTTCTACAATAGGATCTCCTTACTCTCCATGGATCCGTGAACTCAAATCCGATGAACGAGGACTATACTTAATTCACCTCCTCCTTAATTGTGCTAATCATGTCGCTTCAAATAGCTTAGATCATGCAAATGCATTTCTTGATCAGATATCTCTTTTGTCCTCACCCGAAGGAGATACAATGCAGAGAATCGCTTCCTACTTCACAGAAGCACTTGCACATAGAATCCTCCGTGCATGGCGCGGGCTTTATCGTTCTCTTACAGCCACTGCTCATATTCCTCAACCAATCGCTGAGCTTGCTCAAGCTCGTAGGCACTTTCTTGATCTTTGCCCCATTTTAAAGCTTTCTTTCATAATATCAAATCAAGTCATTGTAGAAGCCATGGAGGGAGAAAAAATGATTCATGTGATCGATTTCAATGGCACCGACCCTGCCCAATGGGTTGCATTATTGCAAGCTTTAAGCACCCGACCTGAAGGCCCACCTCATTTGAGGATCACTAGCGTGAATGAACACAAAGAAATGTTGAACCACATGGCTGTTATATTATCAGAAGAGGCGGAGAAGTTGGACATACCGTTCCAGTTCAATCCAATCATTTGTCGTATAGATTGCCTTGATATAGAGAGTTTGCGTGTCAAAACCGGTGAGGCATTGGCTATAAGTTCCATTTCAAAGTTGCATTCTCTTCTAGCTTGTGAAGAGAAGTCCAAACCATCTCCTATAGGAAAACAAAGCAACATTTCTCAACTACATAGAATGGTGCAAATGGGGCAAGGGACTTTAGGGGAGTTGATGGAGAAAGATCATGCAAATGGCTATGTACCAAGTCCGGATTCTAGTTCTTCCTCTCCTATCGCACTATGTCCATGTGTTAAGTTGGAGAGTTTCTTGAATTCTCTATGGAGTTTGTCTCCTAAAATAATGGTGGTAACGGAGCAAGAATCCAACCATAACGGAGGGACTCTTAATGAAAGGTTCATCGAAGCTTTGAATTTTTACGCTACGTTGTTCGATTGTTTGGAATCAACGGTTGCTAGGAATTCGGTGGAGAGGTTAAGGGTGGAGAAGATGTTATTTGGAGAGGAAATTAAGAATATCATCTCTTGTGAAGGGTTAGAGAGGAAAGTGAGGCATGAGAAATTGGAAAGGTGGGTGCAAAGGTTCGACGCAACGGGATTTGGAAGAGTTCCATTGAGTTACTTTGCATTGTTGCAAGCTAGAAGAATGATACAAGGGTTCGGATGCGAAGCTTATAAGGTGAAGGAAGAGAATGGTTGTTGCTTCATTTGTTGGCAAGATAGGCCGTTATATTCGGTTTCGGCATGGAGGTGTAGGAGGTATGATTGA

Protein

Gene

Functional annotation

Database	accession number	e-value	annotation
nr	OVA10283.1	1.2e-188	Transcription factor GRAS
Swissprot	Q9LPR8.1	1.6e-161	GRAS family protein 5
trEMBL	A0A200QIE7	8.7e-189	Transcription factor GRAS

Best hit in Arabidopsis

TAIR id	% identity	e-value	bit score	gene aliases	Short description
AT1G50420.1	59.83	1e-165	579	SCL-3;SCL3	scarecrow-like 3

>>>Show top 3 blast result

Query id	Subject id	alignment length	mis matches	gap openings	query start	query end	subject start	subject end	% identity	e-value	bit score
g128746	AT1G50420.1	478	182	5	3	472	7	482	59.83	1e-165	579
g128746	AT1G66350.1	439	230	8	39	474	143	511	30.98	8e-58	221
g128746	AT1G14920.1	439	226	9	39	469	160	529	30.98	7e-57	218

Ortholog group

Species	Genes
Allium cepa	g128746.t1
Allium fistulosum	AfisC6G06576
Allium sativum	Asa8G00513.1
Arabidopsis thaliana	AT1G50420.1
Oryza sativa	LOC_Os01g71970.1

Pfam domain

Pfam ID	Pfam name	type	alignment_start	alignment_end	bit_score	Evalue
PF03514.11	GRAS	Family	48	469	435.1	1.8e-130

Gene Ontology

Accession	Ontology	Name
GO:0005622	C	intracellular
GO:0005575	C	cellular_component
GO:0001101	P	response to acid chemical
GO:0003674	F	molecular_function
GO:0003676	F	nucleic acid binding
GO:0003677	F	DNA binding
GO:0003700	F	transcription factor activity, sequence-specific DNA binding
GO:0005488	F	binding
GO:0005623	C	cell
GO:0005634	C	nucleus
GO:0043231	C	intracellular membrane-bounded organelle
GO:0006355	P	regulation of transcription, DNA-templated
GO:0008150	P	biological_process
GO:0009719	P	response to endogenous stimulus
GO:0009725	P	response to hormone
GO:0009739	P	response to gibberellin
GO:0009889	P	regulation of biosynthetic process
GO:0010033	P	response to organic substance
GO:0010468	P	regulation of gene expression
GO:0010556	P	regulation of macromolecule biosynthetic process
GO:0019219	P	regulation of nucleobase-containing compound metabolic process
GO:0019222	P	regulation of metabolic process
GO:0031323	P	regulation of cellular metabolic process
GO:0031326	P	regulation of cellular biosynthetic process
GO:0033993	P	response to lipid
GO:0042221	P	response to chemical
GO:0043226	C	organelle
GO:0043227	C	membrane-bounded organelle
GO:0043229	C	intracellular organelle
GO:0043565	F	sequence-specific DNA binding
GO:0044424	C	intracellular part
GO:0044464	C	cell part
GO:0050789	P	regulation of biological process
GO:0050794	P	regulation of cellular process
GO:0050896	P	response to stimulus
GO:0051171	P	regulation of nitrogen compound metabolic process
GO:0051252	P	regulation of RNA metabolic process
GO:0060255	P	regulation of macromolecule metabolic process
GO:0065007	P	biological regulation
GO:0080090	P	regulation of primary metabolic process
GO:0097159	F	organic cyclic compound binding
GO:1901363	F	heterocyclic compound binding
GO:1901700	P	response to oxygen-containing compound
GO:1903506	P	regulation of nucleic acid-templated transcription
GO:2000112	P	regulation of cellular macromolecule biosynthetic process
GO:2001141	P	regulation of RNA biosynthetic process
GO:0140110

KEGG pathway

KO	Name	Enzyme ID	Pathway	Pathway ID
-	-	-	-	-

Expression pattern in different tissues

Expression pattern in BioProjects

Co-expression network