result

Gene information

Detail information of g132338

Location

Gene	Chr	Start	End	Strand
g132338	Scaffold_42074:HRSCAF_425160	119910	121835	+

Sequences

CDS

Protein

Gene

>g132338.t1
ATGTTCCCTTCAAATAAGAAAGGCGGTAGTATGAATTCTGTAGTGGTATATGATCAAAATAGGCAGCAGCAGCAGCAGCAGCATATGCCATGTGTTCAAGGCGATTCTGGACTTGTTCTTACAACTGATCCTAAACCAAGATTACGTTGGACTGTCGAGCTTCATGATAGATTTGTTGATGCTGTTACTCAGCTTGGTGGCCCTGATAGTATGTGTTTTTGTTTATTTATCTTCTTTTTTGATTTACAACCACTTTTAGTTATCATAGCTCTTTTCATCATTTAATTCTCTAAGCCCAATGAATTAGTTTTCTTCTTCTTTGGTTCTACTTTTAGTTTTAGTTTGGGTTGTTATGGTTGTTCAATTGTAGTAATTGTTTAAGTCTTCCTAAGCCTTAATTAACCCTATTTTTTTTTTCTTCTATATGTTATCTCTCTTATTGATCCTCCAGATTTTGCTAGCTGGTATTCATGTTGTTTTTTTTCAGCTGCTTCATTGTTTTTTTTAATATTGTTTTTCAGAATTGAGTTTCGGTTACAATATTATATCGATTATTTTCATCAATACCTGGCTTGTTTGGCATATATCTGACTTAATTTGTGTTCATGCTTTAATTCACATAGTTAGTAACTCACTGTAAAATCAGATTATGAATTCATCTAACAATATACACTTCTGATTTATTTTTGTAGAGGCAACACCAAAAACAATCATGAGAGTTATGGGTGTAAAAGGTCTTACACTCTACCACCTTAAGAGCCACCTTCAAGTATGTCCATATGCACAGAACTTATTGCATTGAACTTTATTTCTTATATCTTATATTTTTCACTATAAATATGTAGAAATTCAGGCTTGGAAAACAGCCGCATAAAGATTTCAATGATCATTCAGCCAAGGATGGTGAGGGTTTGTCTGCTAATTTACATGCATGTATTTATGTTAAAACTTATCATATATTTTTAAGTTCATAATCTTAAGTATGAGTTCGATTTTTTTCATAGGGTCCGGACTTGATATTCGTAGAAATGTTGTTTCTTCTTCAGGAATGATGGGTCATAACATGAATCATGAGTAAGTTATTATAACCATTTTGTTTTATAGAACAATTTCCCCCTGAACAAATTATTATACTTGGATAAAAAATTATTTTGCTTGCTTTATACATTGCAGTAGGAATGTCCATCTATCAGAAGCTTTGAGGATGCAAATGGAAGTCCAAAGGAGATTACATGAACAACTAGAGGTAAATTTACTATCATCTTACAATATTACCCTCATTCCCATAAGGCCAATGTAAACCTGGATAGGCCCATAAACATCATCTTGAATCATCATCATTTTCTGAAATTTTAGGTGCAAAAACACATACAAATGAGAATTGAAGCTCAAGGAAAGTACATGCAATCGATACTTGAAAAAGCATGCCAAACTCTTGCAAGCGAAAACAATATGGGAAACCAACAAGGAGGTATAGATATGGGATCTCCGTTAAACTACCCTTCTCTTCAAGATCTTCATATCTATGGAGGAGATCAACTTGATGGTTTCTTTCCAAATAATAATGAAACACTAAGTTTAGGTAAGAAGAGGCCTAACCCATACACCAATTCTAATGGTAAAAGCCCTATGATTTGGCCCGATGATCTTCGACTTCAAGATTTGGGATCTCAGGATCAAGACACATCAAAAAGTGATCAACTTCAACTTGCAACATCTCATGTAATTGATAGCGGTATAGATATGGAGTCAATAACCGGCGTTTATGAGCCCAAACCTAATTTTTTGGGAGATAATGAGAAAAAGTTCGATGAATCTTCGAAGCTTGAAAGACCATCTCCAAGAAGAGCTCCAGCGATGGAAAGGCTGAATCCAATGATAAGAAGTGGTGTTTTGAATCAAGCGAGAAATTTATCCTATGGGTAA

Functional annotation

Database	accession number	e-value	annotation
nr	XP_020244725.1	1.2e-113	myb family transcription factor APL-like isoform X1
Swissprot	E5L8F7.1	2.0e-92	Interacting protein of NSP2
trEMBL	A0A6I9SDY9	3.3e-108	myb family transcription factor APL isoform X1

Best hit in Arabidopsis

TAIR id	% identity	e-value	bit score	gene aliases	Short description
AT1G79430.2	54.29	4e-87	318	APL;WDY	Homeodomain-like superfamily protein

>>>Show top 3 blast result

Query id	Subject id	alignment length	mis matches	gap openings	query start	query end	subject start	subject end	% identity	e-value	bit score
g132338	AT1G79430.2	361	103	14	31	351	20	358	54.29	4e-87	318
g132338	AT1G79430.1	315	101	14	77	351	1	293	48.25	5e-58	221
g132338	AT3G24120.1	158	48	2	34	189	30	186	67.72	1e-56	216

Ortholog group

Species	Genes
Allium cepa	g132338.t1
Allium fistulosum	AfisC6G05270
Allium sativum	Asa8G01992.1
Arabidopsis thaliana	AT1G79430.1; AT1G79430.2
Oryza sativa	LOC_Os02g07770.1; LOC_Os06g45410.1

Pfam domain

Pfam ID	Pfam name	type	alignment_start	alignment_end	bit_score	Evalue
PF00249.28	Myb_DNA-binding	Domain	47	97	30.9	2.1e-07
PF14379.3	Myb_CC_LHEQLE	Family	142	188	89.1	9.4e-26

Gene Ontology

Accession	Ontology	Name
GO:0005622	C	intracellular
GO:0005575	C	cellular_component
GO:0003674	F	molecular_function
GO:0003700	F	transcription factor activity, sequence-specific DNA binding
GO:0005623	C	cell
GO:0005634	C	nucleus
GO:0043231	C	intracellular membrane-bounded organelle
GO:0006355	P	regulation of transcription, DNA-templated
GO:0009888	P	tissue development
GO:0008150	P	biological_process
GO:0009889	P	regulation of biosynthetic process
GO:0009891	P	positive regulation of biosynthetic process
GO:0009893	P	positive regulation of metabolic process
GO:0010087	P	phloem or xylem histogenesis
GO:0010088	P	phloem development
GO:0010089	P	xylem development
GO:0010468	P	regulation of gene expression
GO:0010556	P	regulation of macromolecule biosynthetic process
GO:0010557	P	positive regulation of macromolecule biosynthetic process
GO:0010604	P	positive regulation of macromolecule metabolic process
GO:0010628	P	positive regulation of gene expression
GO:0045935	P	positive regulation of nucleobase-containing compound metabolic process
GO:0045893	P	positive regulation of transcription, DNA-templated
GO:0019219	P	regulation of nucleobase-containing compound metabolic process
GO:0019222	P	regulation of metabolic process
GO:0031323	P	regulation of cellular metabolic process
GO:0031325	P	positive regulation of cellular metabolic process
GO:0031326	P	regulation of cellular biosynthetic process
GO:0031328	P	positive regulation of cellular biosynthetic process
GO:0032502	P	developmental process
GO:0043226	C	organelle
GO:0043227	C	membrane-bounded organelle
GO:0043229	C	intracellular organelle
GO:0044424	C	intracellular part
GO:0044464	C	cell part
GO:0048518	P	positive regulation of biological process
GO:0048522	P	positive regulation of cellular process
GO:0048856	P	anatomical structure development
GO:0050789	P	regulation of biological process
GO:0050794	P	regulation of cellular process
GO:0051171	P	regulation of nitrogen compound metabolic process
GO:0051173	P	positive regulation of nitrogen compound metabolic process
GO:0051252	P	regulation of RNA metabolic process
GO:0051254	P	positive regulation of RNA metabolic process
GO:0060255	P	regulation of macromolecule metabolic process
GO:0065007	P	biological regulation
GO:0080090	P	regulation of primary metabolic process
GO:1902680	P	positive regulation of RNA biosynthetic process
GO:1903506	P	regulation of nucleic acid-templated transcription
GO:1903508	P	positive regulation of nucleic acid-templated transcription
GO:2000112	P	regulation of cellular macromolecule biosynthetic process
GO:2001141	P	regulation of RNA biosynthetic process
GO:0140110

KEGG pathway

KO	Name	Enzyme ID	Pathway	Pathway ID
-	-	-	-	-

Expression pattern in different tissues

Expression pattern in BioProjects

Co-expression network