result

Gene information

Detail information of g136826

Location

Gene	Chr	Start	End	Strand
g136826	CHR2	2189537	2191070	+

Sequences

CDS

Protein

Gene

>g136826.t1
ATGGGCATTCCAACAATATGTGCAAATGATACTAGAGCTTCATCAGAGTTATTAAAACTGACCTCAACTGGTGCTAATCTCTTAAGATCGATGAGATCATCCCCTTCAATTGGGAACTCCCCAAATGCTCAACACCTGTCAAACAATTCTTCACCTATATTTTTATAGGTAACTAATTGACTCTTTCAAATAAGATTGTCTAAAATAAACTCTTGACCAAAATCTCACATTTATTATACATTGGATTGTTTATTAGCATGGTGTTTGTAAAACTGAGCATGGACTCATGTCGCTATTGCCGATTTGATGCACATTGTTGTTATTTTCTCTTATCATAATACTACACACATCAAAATCTGTATCATTTTGTGTCCGAGCTTCTTAAATAATGTAAGTATTGTATTTGTAGTTTATTGATTGTGTTTCTCAGATTCAGAGGATGTATCCCTGTGCTTTTTGAGCTCTCTCCGGTAAGTGTTCCTTCATAGGATCCAAATACAGGAATATATGTGCGTGCTCATGATTGTTTGGAAACTTTTGTGTTTATAATAAAATAGGGGCATAAAGAATGGCTTACAGAAGTGAATGTTCTTGGCATAGTGGATCATCCGAATCTTGTGAAACTAATTGGTTACTGTGCTGATGATGATGAAAGAGGAATTCAGTGGCTTCTTGTGTATGAATACATGCATAATGGAAGTGTGATGGATCATCTGTCGCCAAACTCTATTGTACCTCTTACGTGGAATATGCGGTTAAAAATTGCTCTTGATGCTGCTCGCGGCTTGACTTACCTACACGAAGAGATGGACTTTCAGGTGAAACTCGGCTTGTTTTTATTTTTCTTCTCTATACTAATCCAAAACTTTATGTATAATATTCACGAACTATGGATCAACTATAAATAACAGATCATACTTAGAGACTTCAAAACATCCAACATGTTACTGGATGAGAACTATAACACAAAATTGTCAGATTTTGGTTTAGCTAGGCGAGGACCGGAGGGTGAATTAACTCATGTATCAACAGCTGTAAGTACACAGCTTGAAAGTGAATCAATCTGTTGCACTTTACAAACTAATTCTTGTTTTTTGTCTAATGCAGTTATATATCATAGTTTTTGAGACCCCAAGAACACATAAATTAATTAGTAAATCCCAGTTCGAGTGACAAAGTGAATATTAGAATCCTAACTGTCACACATGATTGGTCCGTTGATAATTGTATGAAAACACTCTTTTTAATAGAACAAAATTTTACTTACAAACAAAATGTTAATCATGCCTAGCTATTTTCCTTTAGAGAATATTCCTCTAAAGATGAGCAAAATTCATCGCTTTTTAATCAATGAATGTGCACCTATACTTTCAGGAACAAAAAACGTAATACATCATTTTTAATCAATGAATGTGCACCTATACTTTCAGGAGCAGAGAATGTGACGATAGGCGAGCTCCTGAAGAGAAAAGCAGATGAAGGCGTAATGGTTCTAGTAATGATATGGCAAGATCGGACTTCAATCTCCATTTAA

Functional annotation

Database	accession number	e-value	annotation
nr	XP_020276044.1	7.0e-54	probable serine/threonine-protein kinase PBL19
Swissprot	Q9SF86.1	3.1e-51	Protein PTI-COMPROMISED RECEPTOR-LIKE CYTOPLASMIC KINASE 1
trEMBL	A0A5P1FMG1	5.0e-54	Protein kinase domain-containing protein

Best hit in Arabidopsis

TAIR id	% identity	e-value	bit score	gene aliases	Short description
AT2G39110.1	75.38	9e-54	206		Protein kinase superfamily protein

>>>Show top 3 blast result

Query id	Subject id	alignment length	mis matches	gap openings	query start	query end	subject start	subject end	% identity	e-value	bit score
g136826	AT2G39110.1	130	31	1	60	188	133	262	75.38	9e-54	206
g136826	AT3G09830.2	129	32	0	60	188	127	255	75.19	2e-53	205
g136826	AT3G09830.1	129	32	0	60	188	127	255	75.19	2e-53	205

Ortholog group

Species	Genes
-	-

Pfam domain

Pfam ID	Pfam name	type	alignment_start	alignment_end	bit_score	Evalue
PF00069.22	Pkinase	Domain	62	180	77.0	1.3e-21

Gene Ontology

Accession	Ontology	Name
GO:0005886	C	plasma membrane
GO:0005575	C	cellular_component
GO:0008152	P	metabolic process
GO:0002218	P	activation of innate immune response
GO:0002221	P	pattern recognition receptor signaling pathway
GO:0002253	P	activation of immune response
GO:0002376	P	immune system process
GO:0002682	P	regulation of immune system process
GO:0002684	P	positive regulation of immune system process
GO:0002757	P	immune response-activating signal transduction
GO:0002758	P	innate immune response-activating signal transduction
GO:0002764	P	immune response-regulating signaling pathway
GO:0003674	F	molecular_function
GO:0016020	C	membrane
GO:0006952	P	defense response
GO:0042742	P	defense response to bacterium
GO:0003824	F	catalytic activity
GO:0004672	F	protein kinase activity
GO:0004674	F	protein serine/threonine kinase activity
GO:0004675	F	transmembrane receptor protein serine/threonine kinase activity
GO:0004888	F	transmembrane signaling receptor activity
GO:0007165	P	signal transduction
GO:0007178	P	transmembrane receptor protein serine/threonine kinase signaling pathway
GO:0005623	C	cell
GO:0006464	P	cellular protein modification process
GO:0006468	P	protein phosphorylation
GO:0006793	P	phosphorus metabolic process
GO:0006796	P	phosphate-containing compound metabolic process
GO:0006807	P	nitrogen compound metabolic process
GO:0006950	P	response to stress
GO:0007154	P	cell communication
GO:0007166	P	cell surface receptor signaling pathway
GO:0007167	P	enzyme linked receptor protein signaling pathway
GO:0008150	P	biological_process
GO:0009605	P	response to external stimulus
GO:0009607	P	response to biotic stimulus
GO:0051707	P	response to other organism
GO:0009617	P	response to bacterium
GO:0009889	P	regulation of biosynthetic process
GO:0009987	P	cellular process
GO:0010337	P	regulation of salicylic acid metabolic process
GO:0010565	P	regulation of cellular ketone metabolic process
GO:0010817	P	regulation of hormone levels
GO:0016301	F	kinase activity
GO:0016310	P	phosphorylation
GO:0016740	F	transferase activity
GO:0016772	F	transferase activity, transferring phosphorus-containing groups
GO:0016773	F	phosphotransferase activity, alcohol group as acceptor
GO:0019199	F	transmembrane receptor protein kinase activity
GO:0019222	P	regulation of metabolic process
GO:0019538	P	protein metabolic process
GO:0023052	P	signaling
GO:0044403	P	symbiosis, encompassing mutualism through parasitism
GO:0031323	P	regulation of cellular metabolic process
GO:0031326	P	regulation of cellular biosynthetic process
GO:0031347	P	regulation of defense response
GO:0031349	P	positive regulation of defense response
GO:0032350	P	regulation of hormone metabolic process
GO:0035821	P	modification of morphology or physiology of other organism
GO:0036211	P	protein modification process
GO:0038023	F	signaling receptor activity
GO:0043170	P	macromolecule metabolic process
GO:0043207	P	response to external biotic stimulus
GO:0043412	P	macromolecule modification
GO:0044003	P	modification by symbiont of host morphology or physiology
GO:0044237	P	cellular metabolic process
GO:0044238	P	primary metabolic process
GO:0044260	P	cellular macromolecule metabolic process
GO:0044267	P	cellular protein metabolic process
GO:0044419	P	interspecies interaction between organisms
GO:0044464	C	cell part
GO:0045088	P	regulation of innate immune response
GO:0045089	P	positive regulation of innate immune response
GO:0046885	P	regulation of hormone biosynthetic process
GO:0048518	P	positive regulation of biological process
GO:0048583	P	regulation of response to stimulus
GO:0048584	P	positive regulation of response to stimulus
GO:0050776	P	regulation of immune response
GO:0050778	P	positive regulation of immune response
GO:0050789	P	regulation of biological process
GO:0050794	P	regulation of cellular process
GO:0050896	P	response to stimulus
GO:0051701	P	interaction with host
GO:0051704	P	multi-organism process
GO:0051716	P	cellular response to stimulus
GO:0051817	P	modification of morphology or physiology of other organism involved in symbiotic interaction
GO:0052031	P	modulation by symbiont of host defense response
GO:0052033	P	pathogen-associated molecular pattern dependent induction by symbiont of host innate immune response
GO:0052166	P	positive regulation by symbiont of host innate immune response
GO:0052167	P	modulation by symbiont of host innate immune response
GO:0052169	P	pathogen-associated molecular pattern dependent modulation by symbiont of host innate immune response
GO:0052173	P	response to defenses of other organism involved in symbiotic interaction
GO:0052200	P	response to host defenses
GO:0052255	P	modulation by organism of defense response of other organism involved in symbiotic interaction
GO:0052257	P	pathogen-associated molecular pattern dependent induction by organism of innate immune response of other organism involved in symbiotic interaction
GO:0052305	P	positive regulation by organism of innate immune response in other organism involved in symbiotic interaction
GO:0052306	P	modulation by organism of innate immune response in other organism involved in symbiotic interaction
GO:0052308	P	pathogen-associated molecular pattern dependent modulation by organism of innate immune response in other organism involved in symbiotic interaction
GO:0052509	P	positive regulation by symbiont of host defense response
GO:0052510	P	positive regulation by organism of defense response of other organism involved in symbiotic interaction
GO:0052552	P	modulation by organism of immune response of other organism involved in symbiotic interaction
GO:0052553	P	modulation by symbiont of host immune response
GO:0052555	P	positive regulation by organism of immune response of other organism involved in symbiotic interaction
GO:0052556	P	positive regulation by symbiont of host immune response
GO:0052564	P	response to immune response of other organism involved in symbiotic interaction
GO:0052572	P	response to host immune response
GO:0060089	F	molecular transducer activity
GO:0065007	P	biological regulation
GO:0065008	P	regulation of biological quality
GO:0071704	P	organic substance metabolic process
GO:0071944	C	cell periphery
GO:0075136	P	response to host
GO:0080134	P	regulation of response to stress
GO:0080142	P	regulation of salicylic acid biosynthetic process
GO:0098542	P	defense response to other organism
GO:1901564	P	organonitrogen compound metabolic process
GO:0062012
GO:0140096

KEGG pathway

KO	Name	Enzyme ID	Pathway	Pathway ID
K04733	IRAK4; interleukin-1 receptor-associated kinase 4	EC:2.7.11.1	MAPK signaling pathway	ko04010
			NF-kappa B signaling pathway	ko04064
			Toll-like receptor signaling pathway	ko04620
			Toll and Imd signaling pathway	ko04624
			NOD-like receptor signaling pathway	ko04621
			Neurotrophin signaling pathway	ko04722
K13459	RPS2; disease resistance protein RPS2	EC:-	Plant-pathogen interaction	ko04626

Expression pattern in different tissues

Expression pattern in BioProjects

Co-expression network