result

Gene information

Detail information of g145992

Location

Gene	Chr	Start	End	Strand
g145992	Scaffold_43726:HRSCAF_426812	45184	46218	-

Sequences

CDS

Protein

Gene

>g145992.t1
ATGGGTAAAGGTCGAGCTCCTTGCTGCGCAAAAGTAGGCTTGAATAAGGGTTCGTGGATGCCTGAAGAAGATATGAGACTCATTGCTTATATTAATCAGTATGGCCATGGCAATTGGCGCGCTCTTCCTAGACTTGCCGGTTAGTTTCTTCTCTTACATACATAGATACCACAGTTACCAATGACTTATAAGTCATGAATATATAACACGGGCAAGCATGTTTTACTTTTTATTGATTGATTATATTTAGGGCTTGCGCGATGTGGCAAAAGCTGTAGACTAAGATGGATAAACTATCTTAGGCCCGATATTAAGCGTGGAAATTTTAGCAAAGAGGAAGAAGACACTATTATTAAGCTGCATGGGCTGCTTGGAAACAAGTAGGTTTAATTATCTATTTCTCTGCATCATTTTTATCATTCAATGTACAATTTTATGACTCTTATTTTGTAATACAGATGGTCGAAAATTGCTTCATGTTTGCCAGGAAGAACAGATAATGAAATAAAAAATGTATGGAACACACATTTGAAGAAAAAAATTGCAGCTAAAGATCAAAATTCGAACAACTGGAGTGAACTACAAAAGCATGAAGAAACACCGAGTTCTTCGTCATCGGGGACCAGTGCTTGGGCCTCAAGTTCTGAAAGCGAAAGCAAAACTGGGAAAAGCTTTGAAGAAAGTAACAAGATGGATTTTGCCTTGTCTGACATGGTACAGGATTTCAGTTCTGTGCTGGAGCAACCTTCGGCGTCTTACGATGTGGGACAAAAATGTGAGGACTCTCTGATAGATATACCTGAAATAATGATAGAACCTTCTGAGATTTGGAACATGATCAGTGAGGATGATACTAAGACAAATGAAAATCAAAGTGAACAAAGTTGGAACGATGAAAATTGGATGGCGTACATAGAAAGAGAATTGGAGAGTATTAGGGAAGAAGAATTGGACATTGCAAACATAACTAAGGGTGAAGATCCAGTAGCCAGTTATTTTCAAGGACTACATTCTTTATCATCTCATATGATTTAG

Functional annotation

Database	accession number	e-value	annotation
nr	XP_020260811.1	1.1e-77	myb-related protein Zm1-like
Swissprot	P20024.1	6.1e-60	Myb-related protein Zm1
trEMBL	A0A5P1F2W4	8.2e-78	Myb-related protein Zm1

Best hit in Arabidopsis

TAIR id	% identity	e-value	bit score	gene aliases	Short description
AT1G16490.1	44.66	8e-54	207	ATMYB58;MYB58	myb domain protein 58

>>>Show top 3 blast result

Query id	Subject id	alignment length	mis matches	gap openings	query start	query end	subject start	subject end	% identity	e-value	bit score
g145992	AT1G16490.1	262	106	9	1	246	1	239	44.66	8e-54	207
g145992	AT1G56160.1	119	31	0	1	119	1	119	73.95	6e-53	204
g145992	AT1G79180.1	119	32	0	1	119	1	119	73.11	1e-52	203

Ortholog group

Species	Genes
Allium cepa	g145992.t1
Allium fistulosum	AfisC4G04539
Allium sativum	Asa5G03819.1
Arabidopsis thaliana
Oryza sativa

Pfam domain

Pfam ID	Pfam name	type	alignment_start	alignment_end	bit_score	Evalue
PF00249.28	Myb_DNA-binding	Domain	16	63	51.3	8.5e-14
PF00249.28	Myb_DNA-binding	Domain	69	114	53.9	1.3e-14

Gene Ontology

Accession	Ontology	Name
GO:0000160	P	phosphorelay signal transduction system
GO:0005622	C	intracellular
GO:0005575	C	cellular_component
GO:0000302	P	response to reactive oxygen species
GO:0000981	F	RNA polymerase II transcription factor activity, sequence-specific DNA binding
GO:0000988	F	transcription factor activity, protein binding
GO:0000989	F	transcription factor activity, transcription factor binding
GO:0001067	F	regulatory region nucleic acid binding
GO:0001076	F	transcription factor activity, RNA polymerase II transcription factor binding
GO:0001101	P	response to acid chemical
GO:0001134	F	transcription factor activity, transcription factor recruiting
GO:0001135	F	transcription factor activity, RNA polymerase II transcription factor recruiting
GO:0008152	P	metabolic process
GO:0002218	P	activation of innate immune response
GO:0002237	P	response to molecule of bacterial origin
GO:0002252	P	immune effector process
GO:0002253	P	activation of immune response
GO:0002376	P	immune system process
GO:0002682	P	regulation of immune system process
GO:0002684	P	positive regulation of immune system process
GO:0003674	F	molecular_function
GO:0003676	F	nucleic acid binding
GO:0003677	F	DNA binding
GO:0003700	F	transcription factor activity, sequence-specific DNA binding
GO:0006952	P	defense response
GO:0042742	P	defense response to bacterium
GO:0007165	P	signal transduction
GO:0035556	P	intracellular signal transduction
GO:0005488	F	binding
GO:0005623	C	cell
GO:0005634	C	nucleus
GO:0043231	C	intracellular membrane-bounded organelle
GO:0006355	P	regulation of transcription, DNA-templated
GO:0006357	P	regulation of transcription from RNA polymerase II promoter
GO:0006725	P	cellular aromatic compound metabolic process
GO:0006950	P	response to stress
GO:0006955	P	immune response
GO:0006979	P	response to oxidative stress
GO:0007154	P	cell communication
GO:0008150	P	biological_process
GO:0009058	P	biosynthetic process
GO:0009267	P	cellular response to starvation
GO:0009314	P	response to radiation
GO:0042493	P	response to drug
GO:0009411	P	response to UV
GO:0010038	P	response to metal ion
GO:0009416	P	response to light stimulus
GO:0009605	P	response to external stimulus
GO:0009607	P	response to biotic stimulus
GO:0051707	P	response to other organism
GO:0009617	P	response to bacterium
GO:0009628	P	response to abiotic stimulus
GO:0009642	P	response to light intensity
GO:0009646	P	response to absence of light
GO:0009682	P	induced systemic resistance
GO:0009698	P	phenylpropanoid metabolic process
GO:0009699	P	phenylpropanoid biosynthetic process
GO:0009719	P	response to endogenous stimulus
GO:0009723	P	response to ethylene
GO:0009725	P	response to hormone
GO:0009751	P	response to salicylic acid
GO:0009753	P	response to jasmonic acid
GO:0009755	P	hormone-mediated signaling pathway
GO:0009808	P	lignin metabolic process
GO:0009809	P	lignin biosynthetic process
GO:0009866	P	induced systemic resistance, ethylene mediated signaling pathway
GO:0009873	P	ethylene-activated signaling pathway
GO:0009889	P	regulation of biosynthetic process
GO:0009891	P	positive regulation of biosynthetic process
GO:0009893	P	positive regulation of metabolic process
GO:0009987	P	cellular process
GO:0009991	P	response to extracellular stimulus
GO:0010033	P	response to organic substance
GO:0010035	P	response to inorganic substance
GO:0010039	P	response to iron ion
GO:0010043	P	response to zinc ion
GO:0010468	P	regulation of gene expression
GO:0010556	P	regulation of macromolecule biosynthetic process
GO:0010557	P	positive regulation of macromolecule biosynthetic process
GO:0010604	P	positive regulation of macromolecule metabolic process
GO:0010628	P	positive regulation of gene expression
GO:0044212	F	transcription regulatory region DNA binding
GO:0014070	P	response to organic cyclic compound
GO:0045935	P	positive regulation of nucleobase-containing compound metabolic process
GO:0045893	P	positive regulation of transcription, DNA-templated
GO:0046677	P	response to antibiotic
GO:0019219	P	regulation of nucleobase-containing compound metabolic process
GO:0019222	P	regulation of metabolic process
GO:0019438	P	aromatic compound biosynthetic process
GO:0019748	P	secondary metabolic process
GO:0046686	P	response to cadmium ion
GO:0033554	P	cellular response to stress
GO:0023052	P	signaling
GO:0070887	P	cellular response to chemical stimulus
GO:0030154	P	cell differentiation
GO:0031323	P	regulation of cellular metabolic process
GO:0031325	P	positive regulation of cellular metabolic process
GO:0031326	P	regulation of cellular biosynthetic process
GO:0031328	P	positive regulation of cellular biosynthetic process
GO:0031347	P	regulation of defense response
GO:0031349	P	positive regulation of defense response
GO:0031667	P	response to nutrient levels
GO:0031668	P	cellular response to extracellular stimulus
GO:0031669	P	cellular response to nutrient levels
GO:0032502	P	developmental process
GO:0032870	P	cellular response to hormone stimulus
GO:0034599	P	cellular response to oxidative stress
GO:0034614	P	cellular response to reactive oxygen species
GO:0035690	P	cellular response to drug
GO:0042221	P	response to chemical
GO:0042592	P	homeostatic process
GO:0042594	P	response to starvation
GO:0043207	P	response to external biotic stimulus
GO:0043226	C	organelle
GO:0043227	C	membrane-bounded organelle
GO:0043229	C	intracellular organelle
GO:0043565	F	sequence-specific DNA binding
GO:0044087	P	regulation of cellular component biogenesis
GO:0044237	P	cellular metabolic process
GO:0044249	P	cellular biosynthetic process
GO:0044424	C	intracellular part
GO:0044464	C	cell part
GO:0044550	P	secondary metabolite biosynthetic process
GO:0045087	P	innate immune response
GO:0045088	P	regulation of innate immune response
GO:0045089	P	positive regulation of innate immune response
GO:0050801	P	ion homeostasis
GO:0048518	P	positive regulation of biological process
GO:0048522	P	positive regulation of cellular process
GO:0048583	P	regulation of response to stimulus
GO:0048584	P	positive regulation of response to stimulus
GO:0048869	P	cellular developmental process
GO:0048878	P	chemical homeostasis
GO:0050776	P	regulation of immune response
GO:0050778	P	positive regulation of immune response
GO:0050789	P	regulation of biological process
GO:0050794	P	regulation of cellular process
GO:0050896	P	response to stimulus
GO:0051171	P	regulation of nitrogen compound metabolic process
GO:0051173	P	positive regulation of nitrogen compound metabolic process
GO:0051252	P	regulation of RNA metabolic process
GO:0051254	P	positive regulation of RNA metabolic process
GO:0051365	P	cellular response to potassium ion starvation
GO:0051704	P	multi-organism process
GO:0051716	P	cellular response to stimulus
GO:0055065	P	metal ion homeostasis
GO:0055080	P	cation homeostasis
GO:0060255	P	regulation of macromolecule metabolic process
GO:0065007	P	biological regulation
GO:0065008	P	regulation of biological quality
GO:0071241	P	cellular response to inorganic substance
GO:0071248	P	cellular response to metal ion
GO:0071281	P	cellular response to iron ion
GO:0071310	P	cellular response to organic substance
GO:0071369	P	cellular response to ethylene stimulus
GO:0071495	P	cellular response to endogenous stimulus
GO:0071496	P	cellular response to external stimulus
GO:0071704	P	organic substance metabolic process
GO:0071731	P	response to nitric oxide
GO:0071732	P	cellular response to nitric oxide
GO:0080090	P	regulation of primary metabolic process
GO:0080134	P	regulation of response to stress
GO:0097159	F	organic cyclic compound binding
GO:0097366	P	response to bronchodilator
GO:0097501	P	stress response to metal ion
GO:0098542	P	defense response to other organism
GO:0098771	P	inorganic ion homeostasis
GO:1901360	P	organic cyclic compound metabolic process
GO:1901362	P	organic cyclic compound biosynthetic process
GO:1901363	F	heterocyclic compound binding
GO:1901576	P	organic substance biosynthetic process
GO:1901698	P	response to nitrogen compound
GO:1901699	P	cellular response to nitrogen compound
GO:1901700	P	response to oxygen-containing compound
GO:1901701	P	cellular response to oxygen-containing compound
GO:1902170	P	cellular response to reactive nitrogen species
GO:1902680	P	positive regulation of RNA biosynthetic process
GO:1903338	P	regulation of cell wall organization or biogenesis
GO:1903506	P	regulation of nucleic acid-templated transcription
GO:1903508	P	positive regulation of nucleic acid-templated transcription
GO:1990359	P	stress response to zinc ion
GO:1990532	P	stress response to nickel ion
GO:1990641	P	response to iron ion starvation
GO:2000112	P	regulation of cellular macromolecule biosynthetic process
GO:2000652	P	regulation of secondary cell wall biogenesis
GO:2001141	P	regulation of RNA biosynthetic process
GO:0140110

KEGG pathway

KO	Name	Enzyme ID	Pathway	Pathway ID
K09422	MYBP; transcription factor MYB, plant	EC:-	-	-

Expression pattern in different tissues

Expression pattern in BioProjects

Co-expression network