result

Gene information

Detail information of g166733

Location

Gene	Chr	Start	End	Strand
g166733	Scaffold_46481:HRSCAF_429567	493331	494885	+

Sequences

CDS

Protein

Gene

>g166733.t1
ATGTGGCCTTCTACTTTGGATCCAAGTGAGGTTGCATATTTTGGACATCTATTTACGCCCACAATAATCCAAATCGAACACATGCTACTCACGTACACCCAAACAAACAAAAATGATAAATCCTACTTAAGATGAATATATAAACGTGCCGTTTACGACTGTTAGTAACCTATCATTTTCGTAGAATATAGATAGAAGACTAGCCGCCATCTCTTTTCCTTTATATCCCAATATTCCACTACTCCTATCACCTTCTTCCTCTTCATCCATTTCTTTCATATATCATTTTCTTCTATTTCTCCAAATAATGGAGAATCACAACTACCCTTTGTTTTTCCATCCACAACAATTCATAAACTCCATCAATAACAACAACAATAACAGTACAATCTTCGAAAACATGTATGGAAATGGAACTTCTTCTACTCCGAACCATCAGGAGTATATGAAAAATGAAGAAGACGTTACTAGTTATAAGGAATCGATAGTGACGGAACCGGAAAATAGCAATAACAGCAATGAGAAGGATGACAACAAGAAGGTTAAAGGAGATAAGAAAGTGAGAAGGCAAAGATTTGCATTTCAGACAAGGAGTCAAGTTGATATTCTTGATGATGGTTATAGATGGAGGAAGTATGGCCAAAAAGCTGTCAAGAACAACAATTTTCCCAGGTTTCTTTTCTCTCTCTTTAGATCATTCAATAATTCTTAATTTTCTATTTATAATTGCTTACCTTTAAATATGTTGTTTCTTAGATAGATAACTAAAGGATTAGATGTCCATCTAATGATATATATAACAGTGAAGCATGATATTTATCAGTTCTTGTGAACACAGATAAGAGTTTCAATCGTTTTGATATTCATAAGTTTCCTGGTTTTTTTGGACAGTACAGAAAAAAAGCCCATTCCTTGAACTACTTATTCCACTAAATCAATATGGATTGACTAATATAATATTAATTTTGACTCTTTCTCTACGCATATACATACACATAAATATGTATGTAATATGTATGTATGTATGAATGTATTGTGGAAGAAAATGAAGAAAATAATGATAGTAGAATATGTAGAATATTGTCCATAAATAACACGCCAATGTTGGAATCAATTACTTCTCCATTTTGAAGGGGGCCAAGGAAAGTATGTTTACATGCTTTGTAGTCGTCACATGAATAGTATCACTGTGATGTAATAAGACCGTGCTCTAAAACTGACTTTGAAAAGTCTTCTTTAGCAAGAAAATCATATAATGAAGTAACCTTTTTTTTTTCACTTCTAGAAGTTGGCATTACACACAGACACGGACACAAACACAAACACAAAAACTATATTAATTGGTTTTATCTAAAATAAAACTACAATTAATTTCAGGAGCTACTACAGATGCACGCATCAAGGCTGCAATGTGAAGAAGCAAGTTCAAAGACTATCAAAGGATGAAGGAGTTGTGGTAACTACTTATGAAGGAGTGCACACTCATCCTATTCAGAAGTCCAATGACAATTTTGAGCATATTTTGAACCAAATGCAGATTTATTCAGCATTTTAA

Functional annotation

Database	accession number	e-value	annotation
nr	XP_010913024.1	5.9e-48	probable WRKY transcription factor 75
Swissprot	Q9FYA2.1	1.9e-43	WRKY DNA-binding protein 75
trEMBL	A0A6I9QPM3	4.3e-48	probable WRKY transcription factor 75

Best hit in Arabidopsis

TAIR id	% identity	e-value	bit score	gene aliases	Short description
AT5G13080.1	84.95	8e-45	177	ATWRKY75;WRKY75	WRKY DNA-binding protein 75

>>>Show top 3 blast result

Query id	Subject id	alignment length	mis matches	query start	query end	subject start	subject end	% identity	e-value	bit score
g166733	AT5G13080.1	93	14	139	231	53	145	84.95	8e-45	177
g166733	AT3G01970.1	92	21	140	231	52	143	77.17	4e-39	157
g166733	AT1G64000.1	101	36	129	229	90	190	64.36	2e-34	142

Ortholog group

Species	Genes
Allium cepa	g166733.t1
Allium fistulosum	AfisC2G07318
Allium sativum	Asa0G03874.1
Arabidopsis thaliana	AT3G01970.1; AT5G13080.1
Oryza sativa	LOC_Os11g29870.1

Pfam domain

Pfam ID	Pfam name	type	alignment_start	alignment_end	bit_score	Evalue
PF03106.12	WRKY	Domain	153	210	93.2	8.2e-27

Gene Ontology

Accession	Ontology	Name
GO:0000122	P	negative regulation of transcription from RNA polymerase II promoter
GO:0005622	C	intracellular
GO:0005575	C	cellular_component
GO:0000976	F	transcription regulatory region sequence-specific DNA binding
GO:0000977	F	RNA polymerase II regulatory region sequence-specific DNA binding
GO:0000978	F	RNA polymerase II core promoter proximal region sequence-specific DNA binding
GO:0000987	F	core promoter proximal region sequence-specific DNA binding
GO:0001012	F	RNA polymerase II regulatory region DNA binding
GO:0001067	F	regulatory region nucleic acid binding
GO:0003674	F	molecular_function
GO:0003676	F	nucleic acid binding
GO:0003677	F	DNA binding
GO:0003690	F	double-stranded DNA binding
GO:0003700	F	transcription factor activity, sequence-specific DNA binding
GO:0005488	F	binding
GO:0005623	C	cell
GO:0005634	C	nucleus
GO:0043231	C	intracellular membrane-bounded organelle
GO:0006355	P	regulation of transcription, DNA-templated
GO:0006357	P	regulation of transcription from RNA polymerase II promoter
GO:0006950	P	response to stress
GO:0007275	P	multicellular organism development
GO:0009653	P	anatomical structure morphogenesis
GO:0009888	P	tissue development
GO:0008150	P	biological_process
GO:0009791	P	post-embryonic development
GO:0009889	P	regulation of biosynthetic process
GO:0009890	P	negative regulation of biosynthetic process
GO:0009892	P	negative regulation of metabolic process
GO:0009987	P	cellular process
GO:0010015	P	root morphogenesis
GO:0010053	P	root epidermal cell differentiation
GO:0010055	P	atrichoblast differentiation
GO:0010468	P	regulation of gene expression
GO:0010556	P	regulation of macromolecule biosynthetic process
GO:0010558	P	negative regulation of macromolecule biosynthetic process
GO:0010605	P	negative regulation of macromolecule metabolic process
GO:0010629	P	negative regulation of gene expression
GO:0044212	F	transcription regulatory region DNA binding
GO:0045892	P	negative regulation of transcription, DNA-templated
GO:0019219	P	regulation of nucleobase-containing compound metabolic process
GO:0019222	P	regulation of metabolic process
GO:0022622	P	root system development
GO:0033554	P	cellular response to stress
GO:0030154	P	cell differentiation
GO:0031323	P	regulation of cellular metabolic process
GO:0031324	P	negative regulation of cellular metabolic process
GO:0031326	P	regulation of cellular biosynthetic process
GO:0031327	P	negative regulation of cellular biosynthetic process
GO:0032101	P	regulation of response to external stimulus
GO:0032104	P	regulation of response to extracellular stimulus
GO:0032107	P	regulation of response to nutrient levels
GO:0032501	P	multicellular organismal process
GO:0032502	P	developmental process
GO:0043226	C	organelle
GO:0043227	C	membrane-bounded organelle
GO:0043229	C	intracellular organelle
GO:0043565	F	sequence-specific DNA binding
GO:0043620	P	regulation of DNA-templated transcription in response to stress
GO:0044424	C	intracellular part
GO:0044464	C	cell part
GO:0045934	P	negative regulation of nucleobase-containing compound metabolic process
GO:0048364	P	root development
GO:0048519	P	negative regulation of biological process
GO:0048523	P	negative regulation of cellular process
GO:0048527	P	lateral root development
GO:0048528	P	post-embryonic root development
GO:0048583	P	regulation of response to stimulus
GO:0048731	P	system development
GO:0048856	P	anatomical structure development
GO:0048869	P	cellular developmental process
GO:0050789	P	regulation of biological process
GO:0050794	P	regulation of cellular process
GO:0050896	P	response to stimulus
GO:0051171	P	regulation of nitrogen compound metabolic process
GO:0051172	P	negative regulation of nitrogen compound metabolic process
GO:0051252	P	regulation of RNA metabolic process
GO:0051253	P	negative regulation of RNA metabolic process
GO:0051716	P	cellular response to stimulus
GO:0060255	P	regulation of macromolecule metabolic process
GO:0065007	P	biological regulation
GO:0080090	P	regulation of primary metabolic process
GO:0090558	P	plant epidermis development
GO:0090627	P	plant epidermal cell differentiation
GO:0097159	F	organic cyclic compound binding
GO:0099402	P	plant organ development
GO:1901363	F	heterocyclic compound binding
GO:1902679	P	negative regulation of RNA biosynthetic process
GO:1903506	P	regulation of nucleic acid-templated transcription
GO:1903507	P	negative regulation of nucleic acid-templated transcription
GO:1990837	F	sequence-specific double-stranded DNA binding
GO:2000112	P	regulation of cellular macromolecule biosynthetic process
GO:2000113	P	negative regulation of cellular macromolecule biosynthetic process
GO:2001141	P	regulation of RNA biosynthetic process
GO:0090696
GO:0140110
GO:1905392

KEGG pathway

KO	Name	Enzyme ID	Pathway	Pathway ID
-	-	-	-	-

Expression pattern in different tissues

Expression pattern in BioProjects

Co-expression network