result

Gene information

Detail information of g173107

Location

Gene	Chr	Start	End	Strand
g173107	Scaffold_47287:HRSCAF_430373	582209	584212	+

Sequences

CDS

Protein

Gene

>g173107.t1
ATGAACACCTTCATGCTGTCATCCACCTTTATACCCTCCAAAATCGCCCTACATCGCCGCAGCGTCTGCTATTTCTCCACCCAACCTTCGGCGGCGGCAGTGGTGAAGGTATTCGCTGCCGAGACGCCAGCAAAAGCTTCTGAAGATAAAGCGAAGAAGCCTCTGCGGGGTATCACTAAGCCTAAGCCTGTGTCTCCGGCGCTCGAGGCGGTGGTTGGTGTCAAAGAGATTCCGAGGACTCAAGCGCTTAAAGTTATTTGGGCGTACATAAAGAAGCATAATCTTCAGGTTTAATGTCTTGATTCACTGATTTTTTTTAGAGTTTAGTTTACTGGCTTCTCAGTTGGATTTGAGGAAATTTAGGATATAGCCAGTCAGCGAAGTTTGAGATGGGTTTGATGAAATTGGATTCGTTACTATTGCGTCACTGTATAAAATTAACACATAACTCGCTTTGTTAGTTTGATCATTTATTACAGCAACTATCATTACTTATTTCTGAGAAAAAAAACTTCAGTCTGTTTTTATAATAAGGGTCGTGGACCATGGTCAGCTATGTTAATGCTTTATATTAAGATTAATCTTACTAGAATAAATTGGTGTGTAATTAGATACGACTTATGTAACATGAGATTACAGATAAATTGATTGTTTATGAAGTGTTTGGCATGGCAACCTGAAAATTATTTAGGGTTTACATGATTAAGTAATGAGGGTACACAACATTTTTATGCTTTCATGCTTGGTTTAGTTTAGTTGCTTGAACAGATTATATTTTATGATAAAATCAAGGTTGACGCCCTTTAATGTACCTGCAAATATTGAATTGAATAGGAATTATTTGTTGAGGAGAAACCAACTTGAACCGAGAGTTATGTTTCCTCCCTTTTTTCTTTGAAGTTTTCTAGATTAATTGATTAGGATGAACAAATGCAACTTTGAACAGCAACGTTAATGAATGTATTTTTAGAATCTGTATGCATTTGTATTGAATAAGGAACTATATACACCTAAGGAAGACAAATGTATTTCTTTATAGAATCTATATGCTTCAAGGATGTCAAATGAGCTTTATTTGAAAATCGCACGAACAGAGTAGTCACTATTCATCCAACATCTATACGTGCATTTTATGTGAGGAAGTTTTCACCTAAAAAATCTAAATACATCTTAGAGTCCAGATAGAGCGTGCTTTGTTGTATTGTGTGTTTGGAAAGCAACCTAAACAACTCAAATGTATGAAGAGTGATTGGATAAATAGTGACTAATGTGTTCACATGAGCCATATATAAAAGTAGTGCATTTGGGTCCTTACGAACATATATAATCTACATGCATTTGCGTTGAATAAGTGAAACAGCTAATACTATTTATTTCGCACAATATATATGTAAGTGCTTTTGGCCTCCTTCAAGCATATATGATATCTAAGCACGTTTGACAAGTGCTTATAAGTTGCTAAAACAACTTATTAGTTACTTGTTACTATTTGTGTGTTTGACAAGTGCTTATAAGAAGACAAATAAGTTGTTAATAAGTTGATAAATTATAAGCAATAATTACTTGCTTACAAACTACTTAAAAGTTAGTATTCAAAACTACTTTTAGGTAGAAAATACTAGTTGGTGCCAAACGGATTCTATATGCATTTGGGTTGAATGAGCAAGACAATTAACGACTACAATGTTCTCACACAGGATCCTGATAACAAGAAGATAATCGTGTGCGATGAGAAGCTGAAGGCTGTATTTGCTGGCAAAGAGAGAGTTGGGTTTCTTGAAATTTCTGGCTTGTTGAATCCTCACTTTGCAAAGTGATTATGCTACTTGCCTTCCTGCAAAGAGTGAACTTGAATGATGCTTGTGGTTATTTAGTTGTAGGCAGAAACTTCGATTAGAATTTTTTACTTTTTCTAGGTTGCATTTTCTATCCTATGGAAGGCGCGGTTTGTTGGTCGTATTTTACTGGCAATTCATGATGAAATTGAAAATGGCTTCTCTGTGA

Functional annotation

Database	accession number	e-value	annotation
nr	ONK59928.1	2.2e-34	uncharacterized protein A4U43_C08F12390
Swissprot	Q05024.1	6.3e-10	Protein TRI1
trEMBL	A0A8T3C0D8	3.3e-32	SWIB/MDM2 domain-containing protein

Best hit in Arabidopsis

TAIR id	% identity	e-value	bit score	gene aliases	Short description
AT4G34290.1	70.24	2e-30	128		SWIB/MDM2 domain superfamily protein

>>>Show top 3 blast result

Query id	Subject id	alignment length	mis matches	gap openings	query start	query end	subject start	subject end	% identity	e-value	bit score
g173107	AT4G34290.1	84	24	1	50	133	61	143	70.24	2e-30	128
g173107	AT2G14880.1	115	50	2	21	133	27	140	53.91	2e-28	122
g173107	AT3G03590.1	89	37	1	47	133	51	139	56.18	3e-22	101

Ortholog group

Species	Genes
Allium cepa	g173107.t1; g465741.t1
Allium fistulosum	AfisC2G07560; AfisC5G00564
Allium sativum	Asa3G01996.1; Asa4G03143.1
Arabidopsis thaliana	AT2G14880.1; AT4G34290.1
Oryza sativa	LOC_Os03g55310.1; LOC_Os12g32280.1

Pfam domain

Pfam ID	Pfam name	type	alignment_start	alignment_end	bit_score	Evalue
PF02201.15	SWIB	Domain	62	133	95.2	1.4e-27

Gene Ontology

Accession	Ontology	Name
GO:0000120	C	RNA polymerase I transcription factor complex
GO:0005622	C	intracellular
GO:0005575	C	cellular_component
GO:0000500	C	RNA polymerase I upstream activating factor complex
GO:0005623	C	cell
GO:0005634	C	nucleus
GO:0005667	C	transcription factor complex
GO:0005730	C	nucleolus
GO:0043231	C	intracellular membrane-bounded organelle
GO:0006355	P	regulation of transcription, DNA-templated
GO:0006356	P	regulation of transcription from RNA polymerase I promoter
GO:0008150	P	biological_process
GO:0009889	P	regulation of biosynthetic process
GO:0009891	P	positive regulation of biosynthetic process
GO:0009893	P	positive regulation of metabolic process
GO:0010468	P	regulation of gene expression
GO:0010556	P	regulation of macromolecule biosynthetic process
GO:0010557	P	positive regulation of macromolecule biosynthetic process
GO:0010604	P	positive regulation of macromolecule metabolic process
GO:0010628	P	positive regulation of gene expression
GO:0045935	P	positive regulation of nucleobase-containing compound metabolic process
GO:0045893	P	positive regulation of transcription, DNA-templated
GO:0019219	P	regulation of nucleobase-containing compound metabolic process
GO:0019222	P	regulation of metabolic process
GO:0031323	P	regulation of cellular metabolic process
GO:0031325	P	positive regulation of cellular metabolic process
GO:0031326	P	regulation of cellular biosynthetic process
GO:0031328	P	positive regulation of cellular biosynthetic process
GO:0031974	C	membrane-enclosed lumen
GO:0031981	C	nuclear lumen
GO:0032991	C	macromolecular complex
GO:0043226	C	organelle
GO:0043227	C	membrane-bounded organelle
GO:0043228	C	non-membrane-bounded organelle
GO:0043229	C	intracellular organelle
GO:0043232	C	intracellular non-membrane-bounded organelle
GO:0043233	C	organelle lumen
GO:0044422	C	organelle part
GO:0044424	C	intracellular part
GO:0044428	C	nuclear part
GO:0044446	C	intracellular organelle part
GO:0044452	C	nucleolar part
GO:0044464	C	cell part
GO:0044798	C	nuclear transcription factor complex
GO:0045943	P	positive regulation of transcription from RNA polymerase I promoter
GO:0048518	P	positive regulation of biological process
GO:0048522	P	positive regulation of cellular process
GO:0050789	P	regulation of biological process
GO:0050794	P	regulation of cellular process
GO:0051171	P	regulation of nitrogen compound metabolic process
GO:0051173	P	positive regulation of nitrogen compound metabolic process
GO:0051252	P	regulation of RNA metabolic process
GO:0051254	P	positive regulation of RNA metabolic process
GO:0060255	P	regulation of macromolecule metabolic process
GO:0065007	P	biological regulation
GO:0070013	C	intracellular organelle lumen
GO:0080090	P	regulation of primary metabolic process
GO:1902680	P	positive regulation of RNA biosynthetic process
GO:1903506	P	regulation of nucleic acid-templated transcription
GO:1903508	P	positive regulation of nucleic acid-templated transcription
GO:2000112	P	regulation of cellular macromolecule biosynthetic process
GO:2001141	P	regulation of RNA biosynthetic process

KEGG pathway

KO	Name	Enzyme ID	Pathway	Pathway ID
-	-	-	-	-

Expression pattern in different tissues

Expression pattern in BioProjects

Co-expression network