result

Gene information

Detail information of g177201

Location

Gene	Chr	Start	End	Strand
g177201	CHR2	432527986	432529354	-

Sequences

CDS

Protein

Gene

>g177201.t1
ATGTATTTGAATAATTTAGCGAAATTATTATGCATTACAGAGAAAAAAGGTAGAATGGCTTTAAATGGAAATTTCATGGATGATCAACTTGACATAATGTGCGAGGGGTTCTTTGATAACATCGATGATTTGTTGGACTTTTCGATCGATGATCAACCTCTCGGAATGTCCGATTCTGGAAATTCTCTGCTCGATATTCCTTTGCCTGCTCAGTTTTCTGTTCCAGATGGCAAGGATTGCCGCATTGCACCCAACTCTCAAGAAACCAAAATCGTATGTTTTCATTTATTTGTATCTTCTTTATACTGTGAGCAATTTGAACCTATAACATTGGTACATGTTCATAGTTCTATTATTGTACAGATTATAAAAACGTATTTTTCTTAATTTGAAGGGTTCTTCTAGTAGTTATTGACTTATTTATGTGACTTAAGTGGTTGGCAAAATTTAAGTCATTGCTTTGAAAGTTACAAATACTCGTGACTTAATTCCGAGCCATATAACTAAATTTTGTTACAATTTCAATCATCTATTCATATACTATTTATCTTTTTTGCTTTACACTCTATGGTATTGATTAAAAGTTACTATTCAACTATAGATTTTCAAATCATCTATCGAATTCAAAACTAAATTTCTAAACTAAATATGATCCAAAATTCCTCTTTTTCAGGGTAATGATATCGGTATCGATGAAGATTGGATATCAGACTTTCTCTACGACTCAAATTTGGATGCAGAAATCAAGAAGAGCGGTTCTGTCTTCCAATCCTTTAGCCCTACATCCGTGCTTGAACCGACCAATAACACCACCGAAAATGCCTTAATATCATCATCATCCTCGTCCTCCGCTTCGTCGCACGCCATACCACCGCCGCCGTCAGGGACCATGAAACTTCCGGTACCGGCTCGTGCACGTAGCAAGCGCCCGCGTAGGCCCATCATCCCAATCCTCCCTCCGACCGATGGGCCTCCTTCCATCCCGACCATCCTACCCATTACCTCCGAAATCGAACCGAGCCCCCCTAAAAGGATCAAAATCATACAAAGGTCCAGCCTTACAGACCTCAACCCTAACGTCGACGGCATAAGGAAGTGCATGCACTGCGGAATACACAAGACCCCACAGTGGAGGGCCGGCCCGATGGGCCCAAAGACGCTGTGCAATGCCTGTGGGGTCCGGTACAAGTCGGGACGGTTGTTCCCGGAGTACCGGCCCGCCGCTAGCCCTACTTTCGTGCCTAGTGTGCACTCGAACTCTCACAAGAAGGTCGTGGAGATGAGGAACAAGGTCATTGAGCATAAGGTTGCAAAGGAATATAACCCCGCCGCCAAGAATTGTGATTTGCTCAAGTACATTAGGGTTTAA

Functional annotation

Database	accession number	e-value	annotation
nr	XP_020570577.1	8.9e-42	GATA transcription factor 4-like
Swissprot	Q9SV30.1	1.4e-31	GATA transcription factor 8
trEMBL	A0A8T3CC72	1.0e-39	GATA-type domain-containing protein

Best hit in Arabidopsis

TAIR id	% identity	e-value	bit score	gene aliases	Short description
AT1G08010.1	37.29	2e-35	146	GATA11	GATA transcription factor 11

>>>Show top 3 blast result

Query id	Subject id	alignment length	mis matches	gap openings	query start	query end	subject start	subject end	% identity	e-value	bit score
g177201	AT1G08010.2	295	142	10	27	297	11	286	37.29	2e-35	146
g177201	AT1G08010.1	295	142	10	27	297	11	286	37.29	2e-35	146
g177201	AT4G32890.1	275	128	9	41	297	20	263	35.64	7e-35	144

Ortholog group

Species	Genes
Allium cepa	g177201.t1
Allium fistulosum	AfisC2G00036
Allium sativum	Asa0G00803.1
Arabidopsis thaliana
Oryza sativa

Pfam domain

Pfam ID	Pfam name	type	alignment_start	alignment_end	bit_score	Evalue
PF00320.24	GATA	Domain	233	266	55.4	2.9e-15

Gene Ontology

Accession	Ontology	Name
GO:0005515	F	protein binding
GO:0005622	C	intracellular
GO:0005575	C	cellular_component
GO:0000976	F	transcription regulatory region sequence-specific DNA binding
GO:0000977	F	RNA polymerase II regulatory region sequence-specific DNA binding
GO:0000981	F	RNA polymerase II transcription factor activity, sequence-specific DNA binding
GO:0001012	F	RNA polymerase II regulatory region DNA binding
GO:0001067	F	regulatory region nucleic acid binding
GO:0001085	F	RNA polymerase II transcription factor binding
GO:0001228	F	transcriptional activator activity, RNA polymerase II transcription regulatory region sequence-specific binding
GO:0008152	P	metabolic process
GO:0003674	F	molecular_function
GO:0003676	F	nucleic acid binding
GO:0003677	F	DNA binding
GO:0003682	F	chromatin binding
GO:0003690	F	double-stranded DNA binding
GO:0003700	F	transcription factor activity, sequence-specific DNA binding
GO:0006366	P	transcription from RNA polymerase II promoter
GO:0005488	F	binding
GO:0005623	C	cell
GO:0005634	C	nucleus
GO:0005667	C	transcription factor complex
GO:0043231	C	intracellular membrane-bounded organelle
GO:0006139	P	nucleobase-containing compound metabolic process
GO:0006351	P	transcription, DNA-templated
GO:0006355	P	regulation of transcription, DNA-templated
GO:0006357	P	regulation of transcription from RNA polymerase II promoter
GO:0006725	P	cellular aromatic compound metabolic process
GO:0006807	P	nitrogen compound metabolic process
GO:0007275	P	multicellular organism development
GO:0007623	P	circadian rhythm
GO:0008134	F	transcription factor binding
GO:0008150	P	biological_process
GO:0009058	P	biosynthetic process
GO:0009059	P	macromolecule biosynthetic process
GO:0009314	P	response to radiation
GO:0009416	P	response to light stimulus
GO:0009628	P	response to abiotic stimulus
GO:0009791	P	post-embryonic development
GO:0009845	P	seed germination
GO:0009889	P	regulation of biosynthetic process
GO:0009891	P	positive regulation of biosynthetic process
GO:0009893	P	positive regulation of metabolic process
GO:0009987	P	cellular process
GO:0010467	P	gene expression
GO:0010468	P	regulation of gene expression
GO:0010556	P	regulation of macromolecule biosynthetic process
GO:0010557	P	positive regulation of macromolecule biosynthetic process
GO:0010604	P	positive regulation of macromolecule metabolic process
GO:0010628	P	positive regulation of gene expression
GO:0044212	F	transcription regulatory region DNA binding
GO:0016070	P	RNA metabolic process
GO:0045935	P	positive regulation of nucleobase-containing compound metabolic process
GO:0045893	P	positive regulation of transcription, DNA-templated
GO:0018130	P	heterocycle biosynthetic process
GO:0019219	P	regulation of nucleobase-containing compound metabolic process
GO:0019222	P	regulation of metabolic process
GO:0019438	P	aromatic compound biosynthetic process
GO:0030154	P	cell differentiation
GO:0031323	P	regulation of cellular metabolic process
GO:0031325	P	positive regulation of cellular metabolic process
GO:0031326	P	regulation of cellular biosynthetic process
GO:0031328	P	positive regulation of cellular biosynthetic process
GO:0032501	P	multicellular organismal process
GO:0032502	P	developmental process
GO:0032774	P	RNA biosynthetic process
GO:0032991	C	macromolecular complex
GO:0034641	P	cellular nitrogen compound metabolic process
GO:0034645	P	cellular macromolecule biosynthetic process
GO:0034654	P	nucleobase-containing compound biosynthetic process
GO:0043170	P	macromolecule metabolic process
GO:0043226	C	organelle
GO:0043227	C	membrane-bounded organelle
GO:0043229	C	intracellular organelle
GO:0043565	F	sequence-specific DNA binding
GO:0044237	P	cellular metabolic process
GO:0044238	P	primary metabolic process
GO:0044249	P	cellular biosynthetic process
GO:0044260	P	cellular macromolecule metabolic process
GO:0044271	P	cellular nitrogen compound biosynthetic process
GO:0044424	C	intracellular part
GO:0044464	C	cell part
GO:0045944	P	positive regulation of transcription from RNA polymerase II promoter
GO:0046483	P	heterocycle metabolic process
GO:0048511	P	rhythmic process
GO:0048518	P	positive regulation of biological process
GO:0048522	P	positive regulation of cellular process
GO:0048856	P	anatomical structure development
GO:0048869	P	cellular developmental process
GO:0050789	P	regulation of biological process
GO:0050794	P	regulation of cellular process
GO:0050896	P	response to stimulus
GO:0051171	P	regulation of nitrogen compound metabolic process
GO:0051173	P	positive regulation of nitrogen compound metabolic process
GO:0051252	P	regulation of RNA metabolic process
GO:0051254	P	positive regulation of RNA metabolic process
GO:0060255	P	regulation of macromolecule metabolic process
GO:0065007	P	biological regulation
GO:0071704	P	organic substance metabolic process
GO:0080090	P	regulation of primary metabolic process
GO:0090304	P	nucleic acid metabolic process
GO:0090351	P	seedling development
GO:0097159	F	organic cyclic compound binding
GO:0097659	P	nucleic acid-templated transcription
GO:1901360	P	organic cyclic compound metabolic process
GO:1901362	P	organic cyclic compound biosynthetic process
GO:1901363	F	heterocyclic compound binding
GO:1901576	P	organic substance biosynthetic process
GO:1902680	P	positive regulation of RNA biosynthetic process
GO:1903506	P	regulation of nucleic acid-templated transcription
GO:1903508	P	positive regulation of nucleic acid-templated transcription
GO:1990837	F	sequence-specific double-stranded DNA binding
GO:2000112	P	regulation of cellular macromolecule biosynthetic process
GO:2001141	P	regulation of RNA biosynthetic process
GO:0140110

KEGG pathway

KO	Name	Enzyme ID	Pathway	Pathway ID
-	-	-	-	-

Expression pattern in different tissues

Expression pattern in BioProjects

Co-expression network