result

Gene information

Detail information of g186877

Location

Gene	Chr	Start	End	Strand
g186877	CHR8	105204279	105205531	+

Sequences

CDS

Protein

Gene

>g186877.t1
ATGGGAAGATCTCCATGTTGCGATGAGAACGGTCTGAAGAAAGGCCCGTGGACCCCTGAAGAAGATCAAAAGCTTGTTGATTTCATCCAAAAACGTGGTCATGGTAGCTGGAGAGCTCTCCCTAAACTTGCAGGTAAAAGCATAGTTGCATACATAGATTTTCACTACTACTACCAAGTAAGTTGCTCTCATTATAGTTTCATTCTTCTGTTTTATTCGCTTGTTTAGGTCTCAATAGATGTGGGAAGAGTTGCAGATTAAGATGGACGAATTACCTCAGGCCAGATATTAAGAGAGGCAAGTTCTCCCCCGAGGAAGAACAGATCATCCTCAATCTCCACTCCATCCTTGGCAACAAGTAATTTTCCCTTTCCAATTACTATGCTATGTACAAATATATAACTTTGTATTTTTTTTTCCTCGTCAAAAGTGCTTTCAAAAACATACTTCATGCTCAAATACGCTTGAAAACTATTTACAAAAATATATATCACTTTCCAGAAACATATTTCATATATGGACCATATACATTAGCAGTGTCTCAAACATTTGTTTATATCAGATGGTCAGCGATTGCGACACATCTACCAGGAAGAACGGACAACGAGATAAAGAACTTCTGGAACACACATCTTAAAAAGAAACTCATCCAAATGGGCTTCGATCCAATGACACACAGGCCAAGAACCGATGTATTCGCAGCACTTCCTGGCCTTTTAGCCTTGGCCAACCTGTGTGACCTTGTCGATCGTCGCCCATGGGACGATCATTCATTAAACCTCCGCTCTTCGGAATCCAACATCCATCAGTCTGCTCAACTTCAATACTTTCAATACTTGCTCCAGTCTGCAGCAAACAACGTTGCTCAGAACCAAACAAGCCTCAGTCCCAGTAATTCTAATTACATGATCAACAACGGTACAATGCCAACTTCTCATCTTGATCTGGATCTCGATCTGGACCTCGACCTTCCTGAGTCTCAGTTTGGAGGAGGGGATCAGGAATTCGAGCAGCAGATCGTGCAGCCGTGCTATGATGCAAATGACCAGCTAGATTGTTCTGGTTTCGACGATGCATTTTTTGGGCATGGAGAGAATGGTAATTTGCTAGAGTTAGAAAGTCTGCCGCCTCTGATCACAGATGGGTCTGTGGGTCCCACGTCTAGTTCTGAGGGCAGCGATGGATCCGGGTTGTCTTCTTTTTGGGCCCCCGAGCTCTTGCTCCATGACCCATTTACCACCGAGTTCTTTTAA

Functional annotation

Database	accession number	e-value	annotation
nr	XP_020255719.1	4.4e-102	transcription factor MYB39-like
Swissprot	Q9S9Z2.1	1.9e-81	Myb-related protein 93
trEMBL	A0A5P1FBY2	3.2e-102	Transcription factor MYB39

Best hit in Arabidopsis

TAIR id	% identity	e-value	bit score	gene aliases	Short description
AT1G34670.1	72.73	1e-81	300	AtMYB93;MYB93	myb domain protein 93

>>>Show top 3 blast result

Query id	Subject id	alignment length	mis matches	gap openings	query start	query end	subject start	subject end	% identity	e-value	bit score
g186877	AT1G34670.1	198	48	1	1	198	1	192	72.73	1e-81	300
g186877	AT5G10280.1	197	51	3	1	191	1	193	69.04	3e-76	281
g186877	AT5G16770.2	153	29	1	1	150	1	153	79.08	9e-71	263

Ortholog group

Species	Genes
Allium cepa	g186877.t1; g4182.t1
Allium fistulosum	AfisC4G03072; AfisC8G02178
Allium sativum	Asa0G03267.1; Asa1G03041.1; Asa8G00873.1
Arabidopsis thaliana	AT1G34670.1; AT5G65230.1
Oryza sativa	LOC_Os02g51799.1; LOC_Os06g11780.1; LOC_Os08g37970.1

Pfam domain

Pfam ID	Pfam name	type	alignment_start	alignment_end	bit_score	Evalue
PF00249.28	Myb_DNA-binding	Domain	14	61	58.7	4.3e-16
PF00249.28	Myb_DNA-binding	Domain	67	112	61.1	7.5e-17

Gene Ontology

Accession	Ontology	Name
GO:0005622	C	intracellular
GO:0005575	C	cellular_component
GO:0000981	F	RNA polymerase II transcription factor activity, sequence-specific DNA binding
GO:0000988	F	transcription factor activity, protein binding
GO:0000989	F	transcription factor activity, transcription factor binding
GO:0001067	F	regulatory region nucleic acid binding
GO:0001076	F	transcription factor activity, RNA polymerase II transcription factor binding
GO:0001101	P	response to acid chemical
GO:0001134	F	transcription factor activity, transcription factor recruiting
GO:0001135	F	transcription factor activity, RNA polymerase II transcription factor recruiting
GO:0003674	F	molecular_function
GO:0003676	F	nucleic acid binding
GO:0003677	F	DNA binding
GO:0003700	F	transcription factor activity, sequence-specific DNA binding
GO:0005488	F	binding
GO:0005623	C	cell
GO:0005634	C	nucleus
GO:0043231	C	intracellular membrane-bounded organelle
GO:0006355	P	regulation of transcription, DNA-templated
GO:0006357	P	regulation of transcription from RNA polymerase II promoter
GO:0008150	P	biological_process
GO:0042493	P	response to drug
GO:0009719	P	response to endogenous stimulus
GO:0009725	P	response to hormone
GO:0009751	P	response to salicylic acid
GO:0009753	P	response to jasmonic acid
GO:0009889	P	regulation of biosynthetic process
GO:0009987	P	cellular process
GO:0010033	P	response to organic substance
GO:0010468	P	regulation of gene expression
GO:0010556	P	regulation of macromolecule biosynthetic process
GO:0044212	F	transcription regulatory region DNA binding
GO:0014070	P	response to organic cyclic compound
GO:0046677	P	response to antibiotic
GO:0019219	P	regulation of nucleobase-containing compound metabolic process
GO:0019222	P	regulation of metabolic process
GO:0030154	P	cell differentiation
GO:0031323	P	regulation of cellular metabolic process
GO:0031326	P	regulation of cellular biosynthetic process
GO:0032502	P	developmental process
GO:0042221	P	response to chemical
GO:0043226	C	organelle
GO:0043227	C	membrane-bounded organelle
GO:0043229	C	intracellular organelle
GO:0043565	F	sequence-specific DNA binding
GO:0044424	C	intracellular part
GO:0044464	C	cell part
GO:0048869	P	cellular developmental process
GO:0050789	P	regulation of biological process
GO:0050794	P	regulation of cellular process
GO:0050896	P	response to stimulus
GO:0051171	P	regulation of nitrogen compound metabolic process
GO:0051252	P	regulation of RNA metabolic process
GO:0060255	P	regulation of macromolecule metabolic process
GO:0065007	P	biological regulation
GO:0080090	P	regulation of primary metabolic process
GO:0097159	F	organic cyclic compound binding
GO:1901363	F	heterocyclic compound binding
GO:1901700	P	response to oxygen-containing compound
GO:1903506	P	regulation of nucleic acid-templated transcription
GO:2000112	P	regulation of cellular macromolecule biosynthetic process
GO:2001141	P	regulation of RNA biosynthetic process
GO:0140110

KEGG pathway

KO	Name	Enzyme ID	Pathway	Pathway ID
K09422	MYBP; transcription factor MYB, plant	EC:-	-	-

Expression pattern in different tissues

Expression pattern in BioProjects

Co-expression network