result

Gene information

Detail information of g188166

Location

Gene	Chr	Start	End	Strand
g188166	Scaffold_49306:HRSCAF_432392	160066	161157	-

Sequences

CDS

Protein

Gene

>g188166.t1
ATGAACTATGTAATTGTTCAAGTATGTCCATTAGATAACGATGTCTACGTGTTATATAATTGTTTCCATGCACCTAGCTATTATTTCATGACATTAAGCTAGTTGTATTTCAGATAATCTTTTCAAATTACCAACATCTTCCACCTATCTGTATACTGCTTTGGTATACAAACAACGATATGATATTGCTTGTTCTCTAAAACATCTACTGTCTTGTGTAATAGCACTGCTGGTTGCCCATTTGGTGATGGATGTCATTTCCTACACTATGTTCCCGGGGGATATAGCGCAGTTAGTCAACTGAACAATGCTGGAAACCATATGCAGTCGCTGCCTTCTCGTGGCCCAATGGGCCCTCCTCCCATGTCCGACTCTCATGGCCCGCCTGCAGTCAAAACCAAGTTATGCAAAAGGTTTACTTCACCTGAAGGATGCAAATTTGGCAACAAATGCAACTTCGCTCATGGTGAGCATGAGCTTGGAAATCCTCTGAACCAGTTCCATGACATGCCAAGCAACGACTACGATTCAAGGATGGGCCCCCCACCATCATCCAACTTTGGCGGTGGCAGGCCGGGTTACCCATACCATGAGCCCAACCCATCTGGATTTGCAGGCCACAGGATGGGTGGCCCACCAGCACCATCCAGCTTTGGAGCTTCTGCTACTGCAAAAATAAGTGTAGATTCATCTCTTTCTGGTGCTATCATCGGCAAAGGTGGTGTGAACACCAAGCACATATGCCGTGTTACTGGGGCAAAAGTGGCTATTAGGGATCATGAATCCGATTCAAACTTGAAGAATATTGAGCTGGAGGGTACTTTTGACCAGATAAATCAAGCAAGTGCCATGGTCCAGGAGCTGATTATGACTATCAGGTCAGGCCCAGCAGGTCAGATGCCTCCTGTGAAGAAGGCAGGTTTTGGGCAGGCGCCTCCTGCTGCCGCTGCTGGTGGTGGACAAGGGCGACCAAACTTCAGGGCCAAGTTGAAGACCAAGCTTTGTGATAATTTCAGTAAAGGCACCTGCACCTTTGGGGATCAATGCAGTTTTGCTCACGGTGAAAGCGAGTTGCGCCAGTCAGCTATGTAG

Functional annotation

Database	accession number	e-value	annotation
nr	XP_020268161.1	1.5e-81	zinc finger CCCH domain-containing protein 14-like
Swissprot	Q7XPK1.1	6.8e-71	Zinc finger CCCH domain-containing protein 31
trEMBL	A0A5P1ERP1	1.1e-81	Zinc finger CCCH domain-containing protein 14-like

Best hit in Arabidopsis

TAIR id	% identity	e-value	bit score	gene aliases	Short description
AT3G12130.1	45.53	2e-42	169		KH domain-containing protein / zinc finger (CCCH type) family protein

>>>Show top 3 blast result

Query id	Subject id	alignment length	mis matches	gap openings	query start	query end	subject start	subject end	% identity	e-value	bit score
g188166	AT3G12130.1	235	100	5	91	322	38	247	45.53	2e-42	169
g188166	AT3G12130.1	30	7	0	35	64	48	77	76.67	9e-09	57.8
g188166	AT5G06770.1	237	88	6	91	322	38	239	45.99	7e-42	167

Ortholog group

Species	Genes
Allium cepa	g188166.t1; g399449.t1; g503120.t1
Allium fistulosum	AfisC6G03895; AfisC7G01111
Allium sativum	Asa3G03991.1; Asa7G00744.1
Arabidopsis thaliana	AT3G12130.1; AT5G06770.1
Oryza sativa	LOC_Os02g10080.1; LOC_Os02g10080.2; LOC_Os04g57010.1; LOC_Os04g57010.2; LOC_Os06g41384.1; LOC_Os06g41384.2

Pfam domain

Pfam ID	Pfam name	type	alignment_start	alignment_end	bit_score	Evalue
PF14608.3	zf-CCCH_2	Domain	37	48	11.1	0.4
PF00642.21	zf-CCCH	Family	91	116	25.5	8.3e-06
PF00013.26	KH_1	Domain	182	246	42.2	5.1e-11
PF00642.21	zf-CCCH	Family	290	314	39.8	2.7e-10

Gene Ontology

Accession	Ontology	Name
GO:0005622	C	intracellular
GO:0005575	C	cellular_component
GO:0003674	F	molecular_function
GO:0003676	F	nucleic acid binding
GO:0003700	F	transcription factor activity, sequence-specific DNA binding
GO:0003723	F	RNA binding
GO:0005488	F	binding
GO:0005623	C	cell
GO:0005634	C	nucleus
GO:0043231	C	intracellular membrane-bounded organelle
GO:0006355	P	regulation of transcription, DNA-templated
GO:0008150	P	biological_process
GO:0009889	P	regulation of biosynthetic process
GO:0010468	P	regulation of gene expression
GO:0010556	P	regulation of macromolecule biosynthetic process
GO:0019219	P	regulation of nucleobase-containing compound metabolic process
GO:0019222	P	regulation of metabolic process
GO:0031323	P	regulation of cellular metabolic process
GO:0031326	P	regulation of cellular biosynthetic process
GO:0043226	C	organelle
GO:0043227	C	membrane-bounded organelle
GO:0043229	C	intracellular organelle
GO:0044424	C	intracellular part
GO:0044464	C	cell part
GO:0048518	P	positive regulation of biological process
GO:0048831	P	regulation of shoot system development
GO:0050789	P	regulation of biological process
GO:0050793	P	regulation of developmental process
GO:0050794	P	regulation of cellular process
GO:0051094	P	positive regulation of developmental process
GO:0051171	P	regulation of nitrogen compound metabolic process
GO:0051239	P	regulation of multicellular organismal process
GO:0051240	P	positive regulation of multicellular organismal process
GO:0051252	P	regulation of RNA metabolic process
GO:0060255	P	regulation of macromolecule metabolic process
GO:0065007	P	biological regulation
GO:0080090	P	regulation of primary metabolic process
GO:0097159	F	organic cyclic compound binding
GO:1900055	P	regulation of leaf senescence
GO:1900057	P	positive regulation of leaf senescence
GO:1901363	F	heterocyclic compound binding
GO:1903506	P	regulation of nucleic acid-templated transcription
GO:2000024	P	regulation of leaf development
GO:2000026	P	regulation of multicellular organismal development
GO:2000112	P	regulation of cellular macromolecule biosynthetic process
GO:2001141	P	regulation of RNA biosynthetic process
GO:0140110
GO:1905623

KEGG pathway

KO	Name	Enzyme ID	Pathway	Pathway ID
-	-	-	-	-

Expression pattern in different tissues

Expression pattern in BioProjects

Co-expression network