result

Gene information

Detail information of g190987

Location

Gene	Chr	Start	End	Strand
g190987	Scaffold_49761:HRSCAF_432847	552827	553896	+

Sequences

CDS

Protein

Gene

>g190987.t1
ATGGGATATTATCAACGCTCCAATAATGAACTTCCAACCTTTGAACGCTCCTCGTATATATGTATGTGTGTAAACGGACATATACCGGAATCTCATAAGGATATTATTAAGGGTCCAATAACGAATTCCAATGGGGTGTAGGTGAGAGTGTTTATTACCATTGTACTATAGTGGTTATGCACATTGCTATATTTCACCGACAAAGCACTCTGCAAAAATATATCATGTACATTCCCCTTCTCTCTCTACACTGCTTACATTTCAGCCCTGCCATATTCTGAATGTGTACTTCGTTTCATTCTCCGACATCACAAAAAAAAATTGTACTCGGCATTCAATAATTCATCTTTTATATAACTCATGGTCCAATCAAAGAAATTCAGAGGTGTGAGGCAACGCCATTGGGGATCCTGGGTATCAGAGATCCGCCACCCACTCCTGTAAGTCATCAAACACAAAAAACTATATGTTCAATTCCGTTTTAATACTTTGATGAGGTTTTTTGTTTGTGTGTGTGTGTGTGGAAATAATGTCCCAGCAAGAGAAGAGTGTGGCTAGGTACATTTGAGACTGCAGAAGAAGCTGCCAGAGCTTATGATGAAGCTGCAATACTAATGAGTGGCAGAAACGCAAAAACAAATTTCCCAGTTCAAAAGGCTGAAGATTCGCAACTAGGAAAACACATACCTGCTGCAGCTTCAAATAGCAATTTATCTGACGTCTTGAGTGCAAAATTGCGCAAATGCTGCAAAACACCATCTCCTTCACTTACTTGCTTGAGGCTTGATACTGAAAACTCCAATATTGGTGTATGGCAAAAACGTGCAGGGACTCGTGCTGATTCAAATTGGGTCATGACAGTTCAACTCAATAAAATGGAGGTACCTGCACAGAACGAAGACACGTTAGCTTCACCATCTGTTACATCTGAAGGAACTTCATCGTCATCTAATCAAGATATCACAGGAATTAATGATGAAGACAGATTAGCATTGCAAATGGTTGAGGAGCTTCTCAATGGGAACTCTCCAACCTCATCCTCGCATGATGTCTTTTCAATGCAGTACTGA

Functional annotation

Database	accession number	e-value	annotation
nr	XP_020251321.1	1.4e-56	ethylene-responsive transcription factor WIN1
Swissprot	Q9XI33.1	2.5e-42	Protein WAX INDUCER 1
trEMBL	A0A2T7F3D6	1.2e-54	AP2/ERF domain-containing protein

Best hit in Arabidopsis

TAIR id	% identity	e-value	bit score	gene aliases	Short description
AT1G15360.1	53.89	3e-47	185	AtSHN1;SHN1;WIN1	Integrase-type DNA-binding superfamily protein

>>>Show top 3 blast result

Query id	Subject id	alignment length	mis matches	gap openings	query start	query end	subject start	subject end	% identity	e-value	bit score
g190987	AT1G15360.1	193	67	5	79	257	15	199	53.89	3e-47	185
g190987	AT5G25390.2	186	76	4	79	263	15	185	50.54	3e-42	168
g190987	AT5G11190.1	181	75	4	79	255	15	187	51.93	5e-39	158

Ortholog group

Species	Genes
Allium cepa	g190986.t1; g190987.t1
Allium fistulosum	AfisC6G03198; AfisC6G03199
Allium sativum	Asa8G03718.1; Asa8G03719.1
Arabidopsis thaliana	AT1G15360.1; AT5G11190.1; AT5G25390.1; AT5G25390.2
Oryza sativa	LOC_Os02g10760.1; LOC_Os06g40150.1

Pfam domain

Pfam ID	Pfam name	type	alignment_start	alignment_end	bit_score	Evalue
PF00847.17	AP2	Domain	82	121	28.0	1.8e-06

Gene Ontology

Accession	Ontology	Name
GO:0000160	P	phosphorelay signal transduction system
GO:0001101	P	response to acid chemical
GO:0008152	P	metabolic process
GO:0003674	F	molecular_function
GO:0003676	F	nucleic acid binding
GO:0003677	F	DNA binding
GO:0003700	F	transcription factor activity, sequence-specific DNA binding
GO:0007165	P	signal transduction
GO:0035556	P	intracellular signal transduction
GO:0005488	F	binding
GO:0006355	P	regulation of transcription, DNA-templated
GO:0006950	P	response to stress
GO:0007154	P	cell communication
GO:0008150	P	biological_process
GO:0009058	P	biosynthetic process
GO:0009059	P	macromolecule biosynthetic process
GO:0009414	P	response to water deprivation
GO:0009415	P	response to water
GO:0009628	P	response to abiotic stimulus
GO:0009719	P	response to endogenous stimulus
GO:0009723	P	response to ethylene
GO:0009725	P	response to hormone
GO:0009755	P	hormone-mediated signaling pathway
GO:0009873	P	ethylene-activated signaling pathway
GO:0009889	P	regulation of biosynthetic process
GO:0009987	P	cellular process
GO:0010033	P	response to organic substance
GO:0010035	P	response to inorganic substance
GO:0010143	P	cutin biosynthetic process
GO:0010166	P	wax metabolic process
GO:0010468	P	regulation of gene expression
GO:0010556	P	regulation of macromolecule biosynthetic process
GO:0019219	P	regulation of nucleobase-containing compound metabolic process
GO:0019222	P	regulation of metabolic process
GO:0023052	P	signaling
GO:0070887	P	cellular response to chemical stimulus
GO:0031323	P	regulation of cellular metabolic process
GO:0031326	P	regulation of cellular biosynthetic process
GO:0032870	P	cellular response to hormone stimulus
GO:0042221	P	response to chemical
GO:0043170	P	macromolecule metabolic process
GO:0043565	F	sequence-specific DNA binding
GO:0050789	P	regulation of biological process
GO:0050794	P	regulation of cellular process
GO:0050896	P	response to stimulus
GO:0051171	P	regulation of nitrogen compound metabolic process
GO:0051252	P	regulation of RNA metabolic process
GO:0051716	P	cellular response to stimulus
GO:0060255	P	regulation of macromolecule metabolic process
GO:0065007	P	biological regulation
GO:0071310	P	cellular response to organic substance
GO:0071369	P	cellular response to ethylene stimulus
GO:0071495	P	cellular response to endogenous stimulus
GO:0071704	P	organic substance metabolic process
GO:0080090	P	regulation of primary metabolic process
GO:0097159	F	organic cyclic compound binding
GO:1901363	F	heterocyclic compound binding
GO:1901568	P	fatty acid derivative metabolic process
GO:1901576	P	organic substance biosynthetic process
GO:1901700	P	response to oxygen-containing compound
GO:1903506	P	regulation of nucleic acid-templated transcription
GO:2000112	P	regulation of cellular macromolecule biosynthetic process
GO:2001141	P	regulation of RNA biosynthetic process
GO:0140110

KEGG pathway

KO	Name	Enzyme ID	Pathway	Pathway ID
-	-	-	-	-

Expression pattern in different tissues

Expression pattern in BioProjects

Co-expression network