result

Gene information

Detail information of g195594

Location

Gene	Chr	Start	End	Strand
g195594	Scaffold_50374:HRSCAF_433460	145543	147229	-

Sequences

CDS

Protein

Gene

>g195594.t1
ATGACAAATAGACATATCAAATATTCTACACAAAATCACACGATGAGCAAATATTCTCCATCTTCTTCCTCTTCAAAAAATGTATTTGTTCAAATGTGTGCTCTCTCACTTAATTCATCAAACTCTTCTTCTTTTGTTGACAACAGCTATTCAAATACAACTGCTACCACTAAAGTTCAAGCTGATGATAATGATGCCAGAGAAAAGCAACATAAAATCCAAACAACGTTGCTGCTACAACAACCACTACTACCGAAGAAGGCGAAAACAACGGAACTATGAATGATGTTCAGTCGAAACTATGCTCAAGAGGACATTGGAGACCTGCTGAAGACTCTAAACTCAAAGAACTTGTTACTCTTTATGGCCCTCAAAACTGGAATCTCATTGCTGAAAAACTTGAGGGAAGATCAGGTATTTGTTACGTATACACGTTTCTTCATCTATAAAATAGATATTTTTCTCCTTTTTTTATTTTTTTTTAAAAAGAAATAAAGAAATCAACAATTTGCTGTATGTAGGGAAGAGCTGTAGACTAAGATGGTTCAACCAATTGGACCCACGAATAAACAGAAGAGCATTTAGTGACGAAGAAGAAGAGAAATTAGTTGCTGCTCATAGACTATATGGAAATAAGTGGGCTATGATTGCGAGACTATTTCCAGGTAGAACTGATAATGCAGTCAAAAACCATTGGCACGTGATTATGGCAAGAAAATACAGAGAGCAATCAAGTGCTTACAGAAGGAGAAAGCTCATGAATCAGAACTTTGCATCAAAATCTAATTTTTTCACACCAAACTACAATTTTAATAACAATGACAATGGGGTACATTATTCAAATCAGATTGGATTCTGCGCAGAGCAACTCACCGTACCGCCTTTTGAGTTTTTATCAGGTATGTATAAATTCGTGTTTCATATTATTCTTTTATGCACTGCATGCTAAAAAATTTCTGCATTGATTCTTTTTCAGCTTTTGATGGAAGTAGGTGTTGTGGTTGTTAAAGAAAATACTTTTATTAAATTTTTAGTACGAATTTAGAGTATTTTATTCAAGTTCATGAGCATACAAGAATTCAAATTCAAAATGGGTGATATAAAGTATCAATTTATCTTACTTAAAATGTCAATAGTTACTAAAGACTAGATGAAGAAACAACAAAGGAAAGAGGGCTTGGAAATAAATTGTACTTGTATCCGTTACTTTAACATTTATGATCATGTGATAACATTATAGTATGAGTGGAAAAAGATACTGATATAATTTTCTGGATAGCAAGGAAGTCAAATAAAGCAAATGCTTTTACCTTTCGAATCATAATTTGCATTTCAGTAGTAGTGGCTAATAACTGATATAATTTCTTGTTATTATTAAATGGCAGCTCCAGATGTTGAGGGTAAATCAAGATTAGTGAATACTGAAAAAAGAAATAGAGAGATCAATGAGCCTAACTTTAAGGATTTCTTATTACCTCACTACAATCCTTTCATGTTTGCAATGCAACAATCTTGTTATCCGTCACACCAAAATATATCAAGTTCGGAATACTCGGTGTCGCAGTTTGGGAGTTCTAATACAACTTGTGAAGCAATGCCAACGCCTGAAGATAACAATCGAGAAAGCCATTTTGATTCGAGTATTGCGCCTTCGTTTATAGATTTTCTTGGGGTTGGAGCGACTTAG

Functional annotation

Database	accession number	e-value	annotation
nr	XP_010939814.1	1.5e-71	transcription factor MYB52
Swissprot	Q9LQX5.1	6.8e-58	Protein LATERAL ORGAN FUSION 1
trEMBL	A0A6I9SAD6	1.1e-71	transcription factor MYB52

Best hit in Arabidopsis

TAIR id	% identity	e-value	bit score	gene aliases	Short description
AT1G26780.2	88.03	1e-61	233	AtMYB117;LOF1;MYB117	myb domain protein 117

>>>Show top 3 blast result

Query id	Subject id	alignment length	mis matches	query start	query end	subject start	subject end	% identity	e-value	bit score
g195594	AT1G26780.2	117	14	77	193	99	215	88.03	1e-61	233
g195594	AT1G26780.1	117	14	77	193	99	215	88.03	2e-61	232
g195594	AT1G69560.1	114	13	77	190	108	221	88.60	5e-61	231

Ortholog group

Species	Genes
Allium cepa	g195594.t1
Allium fistulosum	AfisC6G04763
Allium sativum	Asa8G02532.1
Arabidopsis thaliana
Oryza sativa

Pfam domain

Pfam ID	Pfam name	type	alignment_start	alignment_end	bit_score	Evalue
PF00249.28	Myb_DNA-binding	Domain	76	121	55.2	5.2e-15
PF00249.28	Myb_DNA-binding	Domain	128	170	51.9	5.7e-14

Gene Ontology

Accession	Ontology	Name
GO:0005622	C	intracellular
GO:0005575	C	cellular_component
GO:0000981	F	RNA polymerase II transcription factor activity, sequence-specific DNA binding
GO:0000988	F	transcription factor activity, protein binding
GO:0000989	F	transcription factor activity, transcription factor binding
GO:0001067	F	regulatory region nucleic acid binding
GO:0001076	F	transcription factor activity, RNA polymerase II transcription factor binding
GO:0001101	P	response to acid chemical
GO:0001134	F	transcription factor activity, transcription factor recruiting
GO:0001135	F	transcription factor activity, RNA polymerase II transcription factor recruiting
GO:0003674	F	molecular_function
GO:0003676	F	nucleic acid binding
GO:0003677	F	DNA binding
GO:0003700	F	transcription factor activity, sequence-specific DNA binding
GO:0006952	P	defense response
GO:0042742	P	defense response to bacterium
GO:0050832	P	defense response to fungus
GO:0005488	F	binding
GO:0005623	C	cell
GO:0005634	C	nucleus
GO:0043231	C	intracellular membrane-bounded organelle
GO:0006355	P	regulation of transcription, DNA-templated
GO:0006357	P	regulation of transcription from RNA polymerase II promoter
GO:0006950	P	response to stress
GO:0006970	P	response to osmotic stress
GO:0008150	P	biological_process
GO:0042493	P	response to drug
GO:0010038	P	response to metal ion
GO:0009414	P	response to water deprivation
GO:0009415	P	response to water
GO:0009605	P	response to external stimulus
GO:0009607	P	response to biotic stimulus
GO:0051707	P	response to other organism
GO:0009617	P	response to bacterium
GO:0009620	P	response to fungus
GO:0009628	P	response to abiotic stimulus
GO:0009651	P	response to salt stress
GO:0009719	P	response to endogenous stimulus
GO:0009723	P	response to ethylene
GO:0009725	P	response to hormone
GO:0009733	P	response to auxin
GO:0009737	P	response to abscisic acid
GO:0009739	P	response to gibberellin
GO:0009751	P	response to salicylic acid
GO:0009753	P	response to jasmonic acid
GO:0009889	P	regulation of biosynthetic process
GO:0009966	P	regulation of signal transduction
GO:0009967	P	positive regulation of signal transduction
GO:0009987	P	cellular process
GO:0010033	P	response to organic substance
GO:0010035	P	response to inorganic substance
GO:0010200	P	response to chitin
GO:0010243	P	response to organonitrogen compound
GO:0010468	P	regulation of gene expression
GO:0010556	P	regulation of macromolecule biosynthetic process
GO:0010646	P	regulation of cell communication
GO:0010647	P	positive regulation of cell communication
GO:0044212	F	transcription regulatory region DNA binding
GO:0010928	P	regulation of auxin mediated signaling pathway
GO:0010929	P	positive regulation of auxin mediated signaling pathway
GO:0014070	P	response to organic cyclic compound
GO:0046677	P	response to antibiotic
GO:0019219	P	regulation of nucleobase-containing compound metabolic process
GO:0019222	P	regulation of metabolic process
GO:0046686	P	response to cadmium ion
GO:0023051	P	regulation of signaling
GO:0023056	P	positive regulation of signaling
GO:0030154	P	cell differentiation
GO:0031323	P	regulation of cellular metabolic process
GO:0031326	P	regulation of cellular biosynthetic process
GO:0032502	P	developmental process
GO:0033993	P	response to lipid
GO:0042221	P	response to chemical
GO:0043207	P	response to external biotic stimulus
GO:0043226	C	organelle
GO:0043227	C	membrane-bounded organelle
GO:0043229	C	intracellular organelle
GO:0043565	F	sequence-specific DNA binding
GO:0044424	C	intracellular part
GO:0044464	C	cell part
GO:0048518	P	positive regulation of biological process
GO:0048522	P	positive regulation of cellular process
GO:0048583	P	regulation of response to stimulus
GO:0048584	P	positive regulation of response to stimulus
GO:0048869	P	cellular developmental process
GO:0050789	P	regulation of biological process
GO:0050794	P	regulation of cellular process
GO:0050896	P	response to stimulus
GO:0051171	P	regulation of nitrogen compound metabolic process
GO:0051252	P	regulation of RNA metabolic process
GO:0051704	P	multi-organism process
GO:0060255	P	regulation of macromolecule metabolic process
GO:0065007	P	biological regulation
GO:0080090	P	regulation of primary metabolic process
GO:0097159	F	organic cyclic compound binding
GO:0097305	P	response to alcohol
GO:0098542	P	defense response to other organism
GO:1901363	F	heterocyclic compound binding
GO:1901698	P	response to nitrogen compound
GO:1901700	P	response to oxygen-containing compound
GO:1903506	P	regulation of nucleic acid-templated transcription
GO:2000022	P	regulation of jasmonic acid mediated signaling pathway
GO:2000031	P	regulation of salicylic acid mediated signaling pathway
GO:2000112	P	regulation of cellular macromolecule biosynthetic process
GO:2001023	P	regulation of response to drug
GO:2001038	P	regulation of cellular response to drug
GO:2001141	P	regulation of RNA biosynthetic process
GO:0140110

KEGG pathway

KO	Name	Enzyme ID	Pathway	Pathway ID
K09422	MYBP; transcription factor MYB, plant	EC:-	-	-

Expression pattern in different tissues

Expression pattern in BioProjects

Co-expression network