result

Gene information

Detail information of g204154

Location

Gene	Chr	Start	End	Strand
g204154	Scaffold_51478:HRSCAF_434564	65675	66898	+

Sequences

CDS

Protein

Gene

>g204154.t1
ATGGCAAGCAACCCCAACACTAACAAAACAACAAATTTCTCATCATCCTCTTCATCTTCCTCCTCTTCAAAATCCTACTCTTCTTCCTCATCCTCTTCATTTCTCCCTCTCCAAACCATGGACCGACTCCGTCAAAATCTCACCTTAACACCACCATATCCTACTCCTCCTCCTCCTCCTATTACCACCACTACCCATTTCCAAGATTTTTTCGGACTTTCCTCGAGAAACACTAGCAGCAACTACCGCAGCACTGCCTTGAGCTTGAATTCCGGTATGGAGTTCGAGTACAATATGAACTGTGGTGAAAACCGTAGTAACGTTGGCATTGTCAGTGCAAATGATCATTTTGTTCCATCCGCAGCTTTCTCTGACTCACTGCACAACATCTGTTCCCCTCCCAACATTGATGGGCTCTTTTCACGGCCGGTGTTGGTTGATGATCCCATCGTCAATGCTGGCGGCGATAAGAAGAAGAAACGTATGATGAAGAACAGAGAGTCTGCTGCTAGGTCAAGGGCTAGAAAACAGGCAAACTCTTCTTTACTTTTTCGTTTATCTTTAATTCAGCATACACATTCACCTAACTTGTGCGTGCACACTCATGTTCATACCGTGCTGTATAGAATTTCTACATGGTAGTGCTGAAATAAGTATTTGTTTAGGCGTTGGATTTAATTATAACCTATTGCTTGATTCTAATCAGCTTTTTTTAAAGTATAGTACAAGTATTGTCTCTGAGAAATTTGCCATTAAGTCTTATGTTTCAGGTGGTTAGAAAATAGAAAAATTGTTGTTATCTTTACACCAAATGTATAATTTGCACAAAGATTTATTAATGTTGTTAAATACAGGCATACACAAATGAATTGGAGGGCGAAGTGGCCCACTTAGAAGCAGAAAATGCAAACCTCAAAAAACAGCTTGGAGAGGTAATGAAGTTCTAATTTATATATTGAATTCATCGTATGATCATTGATTGATAGCAAAATAGTGTATGTTTATGTACCATAAACTGTTTTCACTAACCTATCGTGAGTCACCAAACACTTTACTGTATATATCAGCTTAGTTCATATAATAGTAATAGTACAATTCATTGATGTACATGTTTCAGATCTCATGTGGTTATATATATGATACATGCAGGCACAAAGGGCATTGGCTGCTCAAAACTCTTCAAGAAGGAGCGCTCTTCATAGAACTTTAACTGCTCCATTTTAA

Functional annotation

Database	accession number	e-value	annotation
nr	THU66624.1	1.1e-14	hypothetical protein C4D60_Mb05t16110
Swissprot	Q84JK2.1	6.6e-12	bZIP transcription factor 14
trEMBL	A0A4S8JWI1	8.0e-15	BZIP domain-containing protein

Best hit in Arabidopsis

TAIR id	% identity	e-value	bit score	gene aliases	Short description
AT4G35900.1	39.23	3e-20	95.1	atbzip14;FD;FD-1	Basic-leucine zipper (bZIP) transcription factor family protein

>>>Show top 3 blast result

Query id	Subject id	alignment length	mis matches	gap openings	query start	query end	subject start	subject end	% identity	e-value	bit score
g204154	AT4G35900.1	181	78	5	48	227	136	285	39.23	3e-20	95.1
g204154	AT2G17770.2	145	57	6	84	227	74	195	44.14	2e-19	92.4
g204154	AT2G36270.1	87	42	2	127	211	326	411	48.28	4e-14	75.1

Ortholog group

Species	Genes
Allium cepa	g204154.t1
Allium fistulosum	AfisC5G05171
Allium sativum
Arabidopsis thaliana
Oryza sativa

Pfam domain

Pfam ID	Pfam name	type	alignment_start	alignment_end	bit_score	Evalue
PF00170.18	bZIP_1	Family	156	204	55.6	3.7e-15

Gene Ontology

Accession	Ontology	Name
GO:0005515	F	protein binding
GO:0005622	C	intracellular
GO:0005575	C	cellular_component
GO:0003674	F	molecular_function
GO:0003700	F	transcription factor activity, sequence-specific DNA binding
GO:0005488	F	binding
GO:0005623	C	cell
GO:0005634	C	nucleus
GO:0043231	C	intracellular membrane-bounded organelle
GO:0006355	P	regulation of transcription, DNA-templated
GO:0008150	P	biological_process
GO:0009314	P	response to radiation
GO:0042493	P	response to drug
GO:0009416	P	response to light stimulus
GO:0009628	P	response to abiotic stimulus
GO:0009648	P	photoperiodism
GO:0009889	P	regulation of biosynthetic process
GO:0009891	P	positive regulation of biosynthetic process
GO:0009893	P	positive regulation of metabolic process
GO:0009909	P	regulation of flower development
GO:0009911	P	positive regulation of flower development
GO:0010033	P	response to organic substance
GO:0010200	P	response to chitin
GO:0010243	P	response to organonitrogen compound
GO:0010468	P	regulation of gene expression
GO:0010556	P	regulation of macromolecule biosynthetic process
GO:0010557	P	positive regulation of macromolecule biosynthetic process
GO:0010604	P	positive regulation of macromolecule metabolic process
GO:0010628	P	positive regulation of gene expression
GO:0045935	P	positive regulation of nucleobase-containing compound metabolic process
GO:0045893	P	positive regulation of transcription, DNA-templated
GO:0019219	P	regulation of nucleobase-containing compound metabolic process
GO:0019222	P	regulation of metabolic process
GO:0031323	P	regulation of cellular metabolic process
GO:0031325	P	positive regulation of cellular metabolic process
GO:0031326	P	regulation of cellular biosynthetic process
GO:0031328	P	positive regulation of cellular biosynthetic process
GO:0042221	P	response to chemical
GO:0043226	C	organelle
GO:0043227	C	membrane-bounded organelle
GO:0043229	C	intracellular organelle
GO:0043621	F	protein self-association
GO:0044424	C	intracellular part
GO:0044464	C	cell part
GO:0048518	P	positive regulation of biological process
GO:0048522	P	positive regulation of cellular process
GO:0048580	P	regulation of post-embryonic development
GO:0048582	P	positive regulation of post-embryonic development
GO:0048583	P	regulation of response to stimulus
GO:0048831	P	regulation of shoot system development
GO:0050789	P	regulation of biological process
GO:0050793	P	regulation of developmental process
GO:0050794	P	regulation of cellular process
GO:0050896	P	response to stimulus
GO:0051094	P	positive regulation of developmental process
GO:0051171	P	regulation of nitrogen compound metabolic process
GO:0051173	P	positive regulation of nitrogen compound metabolic process
GO:0051239	P	regulation of multicellular organismal process
GO:0051240	P	positive regulation of multicellular organismal process
GO:0051252	P	regulation of RNA metabolic process
GO:0051254	P	positive regulation of RNA metabolic process
GO:0060255	P	regulation of macromolecule metabolic process
GO:0065007	P	biological regulation
GO:0080090	P	regulation of primary metabolic process
GO:1901698	P	response to nitrogen compound
GO:1901700	P	response to oxygen-containing compound
GO:1902680	P	positive regulation of RNA biosynthetic process
GO:1903506	P	regulation of nucleic acid-templated transcription
GO:1903508	P	positive regulation of nucleic acid-templated transcription
GO:2000026	P	regulation of multicellular organismal development
GO:2000028	P	regulation of photoperiodism, flowering
GO:2000112	P	regulation of cellular macromolecule biosynthetic process
GO:2000241	P	regulation of reproductive process
GO:2000243	P	positive regulation of reproductive process
GO:2001141	P	regulation of RNA biosynthetic process
GO:0140110

KEGG pathway

KO	Name	Enzyme ID	Pathway	Pathway ID
-	-	-	-	-

Expression pattern in different tissues

Expression pattern in BioProjects

Co-expression network