result

Gene information

Detail information of g208969

Location

Gene	Chr	Start	End	Strand
g208969	Scaffold_52038:HRSCAF_435124	300146	301138	-

Sequences

CDS

>g208969.t1
ATGATGCAAAAGAGGAAAAACCCAAACGACAATCAAACCAAAACCAGGAATCCGGAAAAGAAATACGTAGGAGTAAGACAGCGTCCTTCAGGAAGATGGGTGGCCGAAATCAAAGACACCATCCAAAAGATCCGCGTCTGGCTCGGCACCTACGACACCGCCGAAGCCGCCGCACGCGCCTACGACGAGGCCGCCTGCATCCTCCGCGGGCCCCACACCCGCACCAATTTCTGGCCCCCTTCCGACTCTCCTTCAGCTTTACCCCCTAAAATATCCAATCAGCTCCTCCTTATGCTCAAATCCAAAAGCGCTACTAAAGCAGTGAATCGTGGATTCAGAGGTTCCGAAATCGATTCTTCTGTAGGTCAATCGCCGATTTTCAATAGTATAGTTGCCCCCTTTTCCGCTCCTTGCAGTATTATTGATTTCTCCAGTTATTTACCGGATGATGGTACAAAATTAGACTGTTTCGAACAGAATTTGTATGTTCCTGCTATGAACAGCACAAGTCCTCCTAGCTATAGTGGCGGCGGCGGTGATTGGCCGGAGGGTGAAGAAATTGATGTTAGGGATTTTATGTTTGTGGACGAAATGGAAGGGTTATTTGGGGGTGATTTCTCGGCTTTTGAGGTTGCAGAGGAAATAGCAACGGAGGAAGTGGAAGAGGAAGAGCCGGTTATGAAGAGGATGAAGTATGAACGGAGGGTGTCGGCTTCTTTGTACGCTTTGAACGGCATCTCTGAGTGTTTGAAGCTGAAAGGTGAGCTTGGGGGTAATGGGTTGGAGGAGTTGAAGAGGTCGTGTGATAGGAAAATGAAAGTTATGTTGGAGGATGAGGAGAAGCTGCGTCCTGTAGAACAGTTAGACGACTCTTCTTCTTCTTCACCCTCCTTGCGCTCTTACAGTTCATCTTCTTTTTTTGGTGGGGATGAAGATTTAATGTCGCTGTGGACTTTTCTCGATCTTCCTCCTATTTGTGGGGGAGAACGTTAA

Protein

Gene

Functional annotation

Database	accession number	e-value	annotation
nr	KVH92675.1	6.3e-51	AP2/ERF domain-containing protein
Swissprot	A2Q5W1.1	3.0e-26	Protein ERF REQUIRED FOR NODULATION 1
trEMBL	A0A103XKW9	4.5e-51	AP2/ERF domain-containing protein

Best hit in Arabidopsis

TAIR id	% identity	e-value	bit score	gene aliases	Short description
AT5G19790.1	65.85	8e-25	111	RAP2.11	related to AP2 11

>>>Show top 3 blast result

Query id	Subject id	alignment length	mis matches	query start	query end	subject start	subject end	% identity	e-value	bit score
g208969	AT5G19790.1	82	28	14	95	14	95	65.85	8e-25	111
g208969	AT4G23750.2	71	31	7	77	107	177	56.34	6e-18	88.6
g208969	AT4G23750.1	71	31	7	77	107	177	56.34	6e-18	88.6

Ortholog group

Species	Genes
Allium cepa	g208969.t1
Allium fistulosum	AfisC5G04510
Allium sativum	Asa6G04732.1; Asa6G04734.1
Arabidopsis thaliana
Oryza sativa

Pfam domain

Pfam ID	Pfam name	type	alignment_start	alignment_end	bit_score	Evalue
PF00847.17	AP2	Domain	21	70	51.6	7.3e-14

Gene Ontology

Accession	Ontology	Name
GO:0005622	C	intracellular
GO:0005575	C	cellular_component
GO:0000302	P	response to reactive oxygen species
GO:0003674	F	molecular_function
GO:0003676	F	nucleic acid binding
GO:0003677	F	DNA binding
GO:0003700	F	transcription factor activity, sequence-specific DNA binding
GO:0005488	F	binding
GO:0005623	C	cell
GO:0005634	C	nucleus
GO:0043231	C	intracellular membrane-bounded organelle
GO:0006355	P	regulation of transcription, DNA-templated
GO:0006950	P	response to stress
GO:0006979	P	response to oxidative stress
GO:0007275	P	multicellular organism development
GO:0008150	P	biological_process
GO:0010038	P	response to metal ion
GO:0009719	P	response to endogenous stimulus
GO:0009723	P	response to ethylene
GO:0009725	P	response to hormone
GO:0009791	P	post-embryonic development
GO:0009889	P	regulation of biosynthetic process
GO:0009987	P	cellular process
GO:0010033	P	response to organic substance
GO:0010035	P	response to inorganic substance
GO:0010468	P	regulation of gene expression
GO:0010556	P	regulation of macromolecule biosynthetic process
GO:0019219	P	regulation of nucleobase-containing compound metabolic process
GO:0019222	P	regulation of metabolic process
GO:0022622	P	root system development
GO:0070887	P	cellular response to chemical stimulus
GO:0031323	P	regulation of cellular metabolic process
GO:0031326	P	regulation of cellular biosynthetic process
GO:0032501	P	multicellular organismal process
GO:0032502	P	developmental process
GO:0035864	P	response to potassium ion
GO:0035865	P	cellular response to potassium ion
GO:0042221	P	response to chemical
GO:0043226	C	organelle
GO:0043227	C	membrane-bounded organelle
GO:0043229	C	intracellular organelle
GO:0043565	F	sequence-specific DNA binding
GO:0044424	C	intracellular part
GO:0044464	C	cell part
GO:0048364	P	root development
GO:0048528	P	post-embryonic root development
GO:0048731	P	system development
GO:0048856	P	anatomical structure development
GO:0050789	P	regulation of biological process
GO:0050794	P	regulation of cellular process
GO:0050896	P	response to stimulus
GO:0051171	P	regulation of nitrogen compound metabolic process
GO:0051252	P	regulation of RNA metabolic process
GO:0051716	P	cellular response to stimulus
GO:0060255	P	regulation of macromolecule metabolic process
GO:0065007	P	biological regulation
GO:0071241	P	cellular response to inorganic substance
GO:0071248	P	cellular response to metal ion
GO:0080090	P	regulation of primary metabolic process
GO:0097159	F	organic cyclic compound binding
GO:0099402	P	plant organ development
GO:1901363	F	heterocyclic compound binding
GO:1901700	P	response to oxygen-containing compound
GO:1903506	P	regulation of nucleic acid-templated transcription
GO:2000112	P	regulation of cellular macromolecule biosynthetic process
GO:2001141	P	regulation of RNA biosynthetic process
GO:0090696
GO:0140110

KEGG pathway

KO	Name	Enzyme ID	Pathway	Pathway ID
K09286	EREBP; EREBP-like factor	EC:-	-	-

Expression pattern in different tissues

Expression pattern in BioProjects

Co-expression network