result

Gene information

Detail information of g223958

Location

Gene	Chr	Start	End	Strand
g223958	Scaffold_54001:HRSCAF_437087	267758	269285	-

Sequences

CDS

Protein

Gene

>g223958.t1
ATGAACTTCTTCGGTTTTACTTTAAATATTAAAGCCTTAAATGACTAGCATAGGAAAAACACACCATTCATTAAATTCTCATAACTGTGAAACTGCAAATTTATCTGTATAAGCTCAAAAAAAATTTGGGAACAGATGGACAGAGATAGCTAAAGTGGTTTCAGGCAGGTATTTTACCTTTCACTGTAACCCCTTCATCTTTATTCATCAGCGTATACTTTTCTCTCTGGATTTTATGGGAAGAAAGCAAGGTTAATGTTGTGTAAAGTTCATTTTTGCAGAACAGATAATGCTGTAAAGAACCGATTTTCTACATTGTGCAAGAAAAGGTCTAAGCATGAAGCTTTATCAAAGGAGAACAATGACCCATTAGCTTGCACAAGTAACAAAAGGATCTTAGTTCATAATGAGCCTATGATGCCTAGGAGTGTGGAGTTATCAGTACCCATGAAACATATATATCAGGTATATGCGTATCATTATCGTATTTGTTATGGGAATTTACGACTCCAGTGGAAATTATAGATCAAATAAGTTTTAAAGGCTCATGTAATTTTGTTTACGTTTCAAAGACAATGATAAATAGAATTTTCTTTTTATAAAAAGACATTCAACTGTTTAAGGTATACTTGTACATCTGTTTCTTTTATTTTTTACAAAAAGAAAGAAAGCAACAAATTTTTTGCTCAAATATACAAAATGCATATACCTTTATATGTAAAGATTTGCATATTCTATACATCTATCTTTGTCCTTTGACTCAAAAAAAAAAGAGCATTGCGGTTATTACTATTTTAAAAGCACTAAATTTACTGTTTGTGTGATGCAGCATTAAAAATTTAAATCTAAATGAGTGAAAATCCACCCAAAAAAAGCTTTCCTTTTAAAGAACTACCCAGAGTCTAGAAAATGCTTGGAAGGTTATCACGTCCACCAAACTTAAAGATTACGTTTTGCACCTTAGTATCTTATATTTGTGATTAAACTTTGTATTATCTGTTCATTTGATTATTCAGGAACTCAATGAGTATTTGGTTCAGAATGGTGGGAAAAGCATTTCTGCAGATGATTTTGAAATGGACTTTGGCATAGATGAATTTAATGGTCTGATAGATGAGCTAAAGAACAACAACACAGTTGAACAGTCATCATGGAGGTATTACCATTATTTCGCACTTTAATTCATCTTAATATGTTTGCACAAAAACAATTTCACACAGTTCCGAGTATAGAGCAATTTCTGAAAAATACGCATGAATGTTAATGTGTCAAACAGTGATTAGAAAATTATAAAATAATATGCCTAAAAATGTTAAACCTGGCATGGAACAAGGTCATGAGGAACATCAAGACAGTTCCTAGCACATAGCAATATCTGAAAAGCAGAGTGATGATGCAACTGCAAAGCAGATTCATATAGCCAGTTGCAGTAAATTTTTTAGGAAACAGATCATATTTTGAGATTTAACAATTCAACATAATGAGAGTATAACTTTTTAGTTCTTACTGTAGTAAAGTGGAGAACTAG

Functional annotation

Database	accession number	e-value	annotation
nr	XP_008780751.1	8.9e-20	transcription factor MYB124 isoform X2
Swissprot	F4IRB4.1	1.4e-17	Myb-related protein 88
trEMBL	A0A6I9RHI3	6.4e-20	transcription factor MYB124 isoform X1

Best hit in Arabidopsis

TAIR id	% identity	e-value	bit score	gene aliases	Short description
AT2G02820.1	61.54	1e-20	95.5	AtMYB88;MYB88	myb domain protein 88

>>>Show top 3 blast result

Query id	Subject id	alignment length	mis matches	gap openings	query start	query end	subject start	subject end	% identity	e-value	bit score
g223958	AT2G02820.1	78	25	2	5	79	96	171	61.54	1e-20	95.5
g223958	AT2G02820.2	78	25	2	5	79	96	171	61.54	1e-20	95.1
g223958	AT1G14350.2	75	25	1	5	79	91	160	60.00	2e-19	91.3

Ortholog group

Species	Genes
Allium cepa	g223958.t1; g261832.t1; g452981.t1; g507606.t1; g512692.t1; g512693.t1; g98829.t1
Allium fistulosum	AfisC1G07351; AfisC3G00584; AfisC3G02105; AfisC4G00505; AfisC5G00791; AfisC5G02829; AfisC6G02485; AfisC7G00113; AfisC8G00439; AfisC8G00566; AfisC8G01605; AfisC8G03037
Allium sativum	Asa1G04400.1
Arabidopsis thaliana	AT1G14350.1; AT1G14350.2; AT2G02820.1; AT2G02820.2
Oryza sativa	LOC_Os07g43420.1

Pfam domain

Pfam ID	Pfam name	type	alignment_start	alignment_end	bit_score	Evalue
PF00249.28	Myb_DNA-binding	Domain	6	34	27.6	2.2e-06

Gene Ontology

Accession	Ontology	Name
GO:0000003	P	reproduction
GO:0005622	C	intracellular
GO:0005575	C	cellular_component
GO:0000278	P	mitotic cell cycle
GO:0000281	P	mitotic cytokinesis
GO:0000910	P	cytokinesis
GO:0000911	P	cytokinesis by cell plate formation
GO:0000981	F	RNA polymerase II transcription factor activity, sequence-specific DNA binding
GO:0000988	F	transcription factor activity, protein binding
GO:0000989	F	transcription factor activity, transcription factor binding
GO:0001067	F	regulatory region nucleic acid binding
GO:0001076	F	transcription factor activity, RNA polymerase II transcription factor binding
GO:0001101	P	response to acid chemical
GO:0001134	F	transcription factor activity, transcription factor recruiting
GO:0001135	F	transcription factor activity, RNA polymerase II transcription factor recruiting
GO:0003006	P	developmental process involved in reproduction
GO:0003674	F	molecular_function
GO:0003676	F	nucleic acid binding
GO:0003677	F	DNA binding
GO:0003700	F	transcription factor activity, sequence-specific DNA binding
GO:0051726	P	regulation of cell cycle
GO:0005488	F	binding
GO:0005623	C	cell
GO:0005634	C	nucleus
GO:0043231	C	intracellular membrane-bounded organelle
GO:0006275	P	regulation of DNA replication
GO:0006355	P	regulation of transcription, DNA-templated
GO:0006357	P	regulation of transcription from RNA polymerase II promoter
GO:0006810	P	transport
GO:0007049	P	cell cycle
GO:0007275	P	multicellular organism development
GO:0009653	P	anatomical structure morphogenesis
GO:0009888	P	tissue development
GO:0008150	P	biological_process
GO:0009553	P	embryo sac development
GO:0009554	P	megasporogenesis
GO:0009628	P	response to abiotic stimulus
GO:0009629	P	response to gravity
GO:0009719	P	response to endogenous stimulus
GO:0009725	P	response to hormone
GO:0009733	P	response to auxin
GO:0009737	P	response to abscisic acid
GO:0009791	P	post-embryonic development
GO:0009889	P	regulation of biosynthetic process
GO:0009893	P	positive regulation of metabolic process
GO:0009914	P	hormone transport
GO:0009926	P	auxin polar transport
GO:0009987	P	cellular process
GO:0010016	P	shoot system morphogenesis
GO:0010033	P	response to organic substance
GO:0010052	P	guard cell differentiation
GO:0010103	P	stomatal complex morphogenesis
GO:0010235	P	guard mother cell cytokinesis
GO:0010374	P	stomatal complex development
GO:0010376	P	stomatal complex formation
GO:0010440	P	stomatal lineage progression
GO:0010444	P	guard mother cell differentiation
GO:0010468	P	regulation of gene expression
GO:0010556	P	regulation of macromolecule biosynthetic process
GO:0010564	P	regulation of cell cycle process
GO:0010604	P	positive regulation of macromolecule metabolic process
GO:0010638	P	positive regulation of organelle organization
GO:0010817	P	regulation of hormone levels
GO:0044212	F	transcription regulatory region DNA binding
GO:0048646	P	anatomical structure formation involved in morphogenesis
GO:0019219	P	regulation of nucleobase-containing compound metabolic process
GO:0019222	P	regulation of metabolic process
GO:0019953	P	sexual reproduction
GO:0022402	P	cell cycle process
GO:0022414	P	reproductive process
GO:0022622	P	root system development
GO:0030104	P	water homeostasis
GO:0030154	P	cell differentiation
GO:0031056	P	regulation of histone modification
GO:0031058	P	positive regulation of histone modification
GO:0031060	P	regulation of histone methylation
GO:0031062	P	positive regulation of histone methylation
GO:0031323	P	regulation of cellular metabolic process
GO:0031325	P	positive regulation of cellular metabolic process
GO:0031326	P	regulation of cellular biosynthetic process
GO:0031399	P	regulation of protein modification process
GO:0031401	P	positive regulation of protein modification process
GO:0032268	P	regulation of cellular protein metabolic process
GO:0032270	P	positive regulation of cellular protein metabolic process
GO:0032501	P	multicellular organismal process
GO:0032502	P	developmental process
GO:0032506	P	cytokinetic process
GO:0032875	P	regulation of DNA endoreduplication
GO:0033043	P	regulation of organelle organization
GO:0033044	P	regulation of chromosome organization
GO:0033993	P	response to lipid
GO:0034293	P	sexual sporulation
GO:0042221	P	response to chemical
GO:0042592	P	homeostatic process
GO:0043226	C	organelle
GO:0043227	C	membrane-bounded organelle
GO:0043229	C	intracellular organelle
GO:0043565	F	sequence-specific DNA binding
GO:0043934	P	sporulation
GO:0044424	C	intracellular part
GO:0044464	C	cell part
GO:0044703	P	multi-organism reproductive process
GO:0047484	P	regulation of response to osmotic stress
GO:0048229	P	gametophyte development
GO:0048236	P	plant-type spore development
GO:0048364	P	root development
GO:0048366	P	leaf development
GO:0048367	P	shoot system development
GO:0048468	P	cell development
GO:0048518	P	positive regulation of biological process
GO:0048522	P	positive regulation of cellular process
GO:0048527	P	lateral root development
GO:0048528	P	post-embryonic root development
GO:0048580	P	regulation of post-embryonic development
GO:0048582	P	positive regulation of post-embryonic development
GO:0048583	P	regulation of response to stimulus
GO:0048584	P	positive regulation of response to stimulus
GO:0048731	P	system development
GO:0048827	P	phyllome development
GO:0048856	P	anatomical structure development
GO:0048869	P	cellular developmental process
GO:0048871	P	multicellular organismal homeostasis
GO:0048878	P	chemical homeostasis
GO:0050789	P	regulation of biological process
GO:0050793	P	regulation of developmental process
GO:0050794	P	regulation of cellular process
GO:0050878	P	regulation of body fluid levels
GO:0050891	P	multicellular organismal water homeostasis
GO:0050896	P	response to stimulus
GO:0051052	P	regulation of DNA metabolic process
GO:0051094	P	positive regulation of developmental process
GO:0051128	P	regulation of cellular component organization
GO:0051130	P	positive regulation of cellular component organization
GO:0051171	P	regulation of nitrogen compound metabolic process
GO:0051173	P	positive regulation of nitrogen compound metabolic process
GO:0051179	P	localization
GO:0051234	P	establishment of localization
GO:0051239	P	regulation of multicellular organismal process
GO:0051240	P	positive regulation of multicellular organismal process
GO:0051246	P	regulation of protein metabolic process
GO:0051247	P	positive regulation of protein metabolic process
GO:0051252	P	regulation of RNA metabolic process
GO:0051301	P	cell division
GO:0051321	P	meiotic cell cycle
GO:0051704	P	multi-organism process
GO:0060255	P	regulation of macromolecule metabolic process
GO:0060918	P	auxin transport
GO:0061085	P	regulation of histone H3-K27 methylation
GO:0061087	P	positive regulation of histone H3-K27 methylation
GO:0061640	P	cytoskeleton-dependent cytokinesis
GO:0065007	P	biological regulation
GO:0065008	P	regulation of biological quality
GO:0080022	P	primary root development
GO:0080090	P	regulation of primary metabolic process
GO:0080134	P	regulation of response to stress
GO:0090329	P	regulation of DNA-dependent DNA replication
GO:0090436	P	leaf pavement cell development
GO:0090558	P	plant epidermis development
GO:0090626	P	plant epidermis morphogenesis
GO:0090627	P	plant epidermal cell differentiation
GO:0097159	F	organic cyclic compound binding
GO:0097305	P	response to alcohol
GO:0099402	P	plant organ development
GO:1901000	P	regulation of response to salt stress
GO:1901002	P	positive regulation of response to salt stress
GO:1901333	P	positive regulation of lateral root development
GO:1901363	F	heterocyclic compound binding
GO:1901700	P	response to oxygen-containing compound
GO:1901987	P	regulation of cell cycle phase transition
GO:1902275	P	regulation of chromatin organization
GO:1902410	P	mitotic cytokinetic process
GO:1902584	P	positive regulation of response to water deprivation
GO:1902806	P	regulation of cell cycle G1/S phase transition
GO:1903046	P	meiotic cell cycle process
GO:1903047	P	mitotic cell cycle process
GO:1903506	P	regulation of nucleic acid-templated transcription
GO:1905269	P	positive regulation of chromatin organization
GO:2000023	P	regulation of lateral root development
GO:2000026	P	regulation of multicellular organismal development
GO:2000037	P	regulation of stomatal complex patterning
GO:2000069	P	regulation of post-embryonic root development
GO:2000070	P	regulation of response to water deprivation
GO:2000112	P	regulation of cellular macromolecule biosynthetic process
GO:2000280	P	regulation of root development
GO:2001141	P	regulation of RNA biosynthetic process
GO:2001252	P	positive regulation of chromosome organization
GO:0090696
GO:0090698
GO:0140110

KEGG pathway

KO	Name	Enzyme ID	Pathway	Pathway ID
K09422	MYBP; transcription factor MYB, plant	EC:-	-	-

Expression pattern in different tissues

Expression pattern in BioProjects

Co-expression network