result

Gene information

Detail information of g239304

Location

Gene	Chr	Start	End	Strand
g239304	Scaffold_56042:HRSCAF_439128	460326	461624	-

Sequences

CDS

>g239304.t1
ATGGCAGGCATGGCATATCAAGAACAATCTAGTGAAATGCACCGCTCTTATCATGAAGGTGACCATGAGGGCGAACTAACCCATTGCAATTACAGTGAGGAGTTCCTAAAACGTAGAATCCAGAGTGACACAAATCTTCTCAACCGCATAAGAAAAAGCAACCTCATGATTCAAAACCATCAGACTGTCCATCCCAGAAAGCACACACAACAAGAAATTGACATGATCATTAGTAGAAAGAAATTCTTGCAAGCGCAAGATGCGATACTCGAACAAATGCTGAAAGTGATGGAATGTTGCAACGCCCAAGGCTTCGTGTACGGCATCGTAACAGAAAATGGCAAGACAGTCTCCGCCGCTTCCGATAACCTACGTGGGTGGTGGAAGGAGAAGGCGAGGTTTGATTTGGATGGTCCGCTGTCTATAGAGAAGTACAAGTCTGTAAACATGTTTCATCTGAGCGAGAAGAAGGCCGACATAAACATCCGTGAAAGACTAATGGAGATTCAGGACACAACGCTAGGGTCCATGCTTTCAGCTCTTATGCCGCACTGTGACCCACCCCAAAGGAAGTTTCCTCTGGAGATGGGGGTGCCCCCTCCATGGCGGCCCACCACGACCGAACAATGGTGGTGTGAGCTTGGGTTCCCAAATGATGATAATGGCCCTCCACCGTATAAAAAGCCTCATGACTTGAAGAAGGTGTGGAAAGTTGGTGTTCTTGTTTCTGTACTTAAACACATTTTGCCAAATACAGATAAGATAAGGCAACTGATCAGGCAATCGAAAAGCCTTCAGAGTAAAATGACTGCAAAGGAGAGTATTGCTTGGTTCGACGTTCTTGATCAGGTAGATCGGGAATTTCAAAGATGCTGCATGGATTTGCCTAATCTGTTTACTAAGTGTAAAAATGCTAGGAAGCTGGATTCTGTAGGAAATGAGGGAGGCAATCAATTTGTTGCATGTAAACGAGTGGCACTGGCAGGGCATGAGTTGAATAAGAATAAGAGTGCTCAGAATAATCTGTCCAGTTGTAGCTCACACACAGACTTTGTTCAATATAATACAAATACAGATAGTACGATGAAACTGAATTCTAATGCAGATGCGGTTATAGATTTCTGTTATGTGCCTGAGTTGAGTATCGAGAGTAATGGCGATCATCAGAGTAATAATGATTATAGAGTTGATAAAGCTGCTGAAGTGGTACAAGATTATGATTTTTCTGGGTTTGCATATTCTGATATGATGGGAAATTTGAATGGCTTGGAAGATTGGTTTGGATCCGGAAGCTGTTGA

Protein

Gene

Functional annotation

Database	accession number	e-value	annotation
nr	XP_020253600.1	9.0e-82	protein ETHYLENE INSENSITIVE 3-like
Swissprot	Q10M41.1	4.1e-71	Protein MAO HUZI 6
trEMBL	A0A5P1FKJ4	6.5e-82	ETHYLENE INSENSITIVE 3-like 1 protein

Best hit in Arabidopsis

TAIR id	% identity	e-value	bit score	gene aliases	Short description
AT3G20770.1	54.40	4e-73	272	AtEIN3;EIN3	Ethylene insensitive 3 family protein

>>>Show top 3 blast result

Query id	Subject id	alignment length	mis matches	gap openings	query start	query end	subject start	subject end	% identity	e-value	bit score
g239304	AT3G20770.1	250	106	4	36	283	51	294	54.40	4e-73	272
g239304	AT2G27050.1	261	108	5	36	288	51	304	52.87	6e-73	271
g239304	AT1G73730.1	260	121	4	36	294	40	292	50.38	4e-70	262

Ortholog group

Species	Genes
Allium cepa	g239304.t1; g239308.t1; g432230.t1
Allium fistulosum	AfisC4G04378; AfisS43G00002
Allium sativum
Arabidopsis thaliana
Oryza sativa

Pfam domain

Pfam ID	Pfam name	type	alignment_start	alignment_end	bit_score	Evalue
PF04873.10	EIN3	Family	36	283	322.0	2e-96

Gene Ontology

Accession	Ontology	Name
GO:0000160	P	phosphorelay signal transduction system
GO:0005622	C	intracellular
GO:0005575	C	cellular_component
GO:0000976	F	transcription regulatory region sequence-specific DNA binding
GO:0001067	F	regulatory region nucleic acid binding
GO:0001666	P	response to hypoxia
GO:0003674	F	molecular_function
GO:0003676	F	nucleic acid binding
GO:0003677	F	DNA binding
GO:0003690	F	double-stranded DNA binding
GO:0003700	F	transcription factor activity, sequence-specific DNA binding
GO:0006952	P	defense response
GO:0042742	P	defense response to bacterium
GO:0007165	P	signal transduction
GO:0035556	P	intracellular signal transduction
GO:0005488	F	binding
GO:0005623	C	cell
GO:0005634	C	nucleus
GO:0043231	C	intracellular membrane-bounded organelle
GO:0006355	P	regulation of transcription, DNA-templated
GO:0006950	P	response to stress
GO:0007154	P	cell communication
GO:0008150	P	biological_process
GO:0010038	P	response to metal ion
GO:0009605	P	response to external stimulus
GO:0009607	P	response to biotic stimulus
GO:0051707	P	response to other organism
GO:0009617	P	response to bacterium
GO:0009628	P	response to abiotic stimulus
GO:0009719	P	response to endogenous stimulus
GO:0009723	P	response to ethylene
GO:0009725	P	response to hormone
GO:0009743	P	response to carbohydrate
GO:0009755	P	hormone-mediated signaling pathway
GO:0009756	P	carbohydrate mediated signaling
GO:0009873	P	ethylene-activated signaling pathway
GO:0009889	P	regulation of biosynthetic process
GO:0009987	P	cellular process
GO:0010033	P	response to organic substance
GO:0010035	P	response to inorganic substance
GO:0010039	P	response to iron ion
GO:0010182	P	sugar mediated signaling pathway
GO:0010468	P	regulation of gene expression
GO:0010556	P	regulation of macromolecule biosynthetic process
GO:0044212	F	transcription regulatory region DNA binding
GO:0019219	P	regulation of nucleobase-containing compound metabolic process
GO:0019222	P	regulation of metabolic process
GO:0023052	P	signaling
GO:0070887	P	cellular response to chemical stimulus
GO:0031323	P	regulation of cellular metabolic process
GO:0031326	P	regulation of cellular biosynthetic process
GO:0032870	P	cellular response to hormone stimulus
GO:0036293	P	response to decreased oxygen levels
GO:0042221	P	response to chemical
GO:0043207	P	response to external biotic stimulus
GO:0043226	C	organelle
GO:0043227	C	membrane-bounded organelle
GO:0043229	C	intracellular organelle
GO:0043565	F	sequence-specific DNA binding
GO:0044424	C	intracellular part
GO:0044464	C	cell part
GO:0050789	P	regulation of biological process
GO:0050794	P	regulation of cellular process
GO:0050896	P	response to stimulus
GO:0051171	P	regulation of nitrogen compound metabolic process
GO:0051252	P	regulation of RNA metabolic process
GO:0051704	P	multi-organism process
GO:0051716	P	cellular response to stimulus
GO:0060255	P	regulation of macromolecule metabolic process
GO:0065007	P	biological regulation
GO:0070482	P	response to oxygen levels
GO:0071241	P	cellular response to inorganic substance
GO:0071248	P	cellular response to metal ion
GO:0071281	P	cellular response to iron ion
GO:0071310	P	cellular response to organic substance
GO:0071322	P	cellular response to carbohydrate stimulus
GO:0071369	P	cellular response to ethylene stimulus
GO:0071495	P	cellular response to endogenous stimulus
GO:0080090	P	regulation of primary metabolic process
GO:0097159	F	organic cyclic compound binding
GO:0098542	P	defense response to other organism
GO:1901363	F	heterocyclic compound binding
GO:1901700	P	response to oxygen-containing compound
GO:1901701	P	cellular response to oxygen-containing compound
GO:1903506	P	regulation of nucleic acid-templated transcription
GO:1990837	F	sequence-specific double-stranded DNA binding
GO:2000112	P	regulation of cellular macromolecule biosynthetic process
GO:2001141	P	regulation of RNA biosynthetic process
GO:0140110

KEGG pathway

KO	Name	Enzyme ID	Pathway	Pathway ID
K14514	EIN3; ethylene-insensitive protein 3	EC:-	MAPK signaling pathway - plant	ko04016
K14514	EIN3; ethylene-insensitive protein 3	EC:-	Plant hormone signal transduction	ko04075

Expression pattern in different tissues

Expression pattern in BioProjects

Co-expression network