result

Gene information

Detail information of g256275

Location

Gene	Chr	Start	End	Strand
g256275	CHR8	115597254	115598261	+

Sequences

CDS

>g256275.t1
ATGGCTGCATCCATAGATATGTATAATAACAGCAATTCTTCCTTCTATTCTCTTAATCCGTTCAACGAGGAGCTTATGCAAGTACTTGAACCTTTTATTCACAGTGCTTCATCCTCTTCGGTTTCTTCACCTAATTTCACTTTCGATACGTCTTCCGCACCTATTTACAATCACCCATGTCATCAAACTCAGTTCTTCGACGAATTTTCACCATCAAAATCGAATCTTTTTACCATGAGCAATCAATCCCCAATCGGTTTAACTCAACTAAGCCCTATTCAGATCCAACAAATTCAAGCTCAAATCCAGTTAAACCAGCAGCACCAGCTCATGATTTCTCGAAGTTTACAAGCAAAAAACAACCAAAATCACACCTTTAACGCAAGATCTCAACCCATGAAACTATCAAGTGCCGTCAGTAGTGCAAAGCCTACAAAATTATACAGAGGCGTAAGGCAACGACACTGGGGTAAATGGGTTGCAGAAATCCGTCTACCAAAGAACAGAACTAGGCTTTGGTTGGGTACTTTTGACACTGTTGAAGAAGCTGCTTTGGCTTACGACAGAGCTGCTTACAAGCTCCGAGGCGATTATGCCCGATTGAACTTTCCTGATCTAAAACAAAGCGGTGTTCACTTGCTTGAAAACAGCTTGTTGCATTCCACGGTTGACGCCAAACTCGAAGCTATTTGTAAGAGTTTGGAAGAGGGTTCTAATGGCGTCAAGGTTAATAAGAAAGAGAAGAAATGCAGCAAGGTTGAGCAAGAAGTAAAGGTCGTCGAGGCCGTCAGTGACGAGTCAAGTTTGAAAATGTTCTCGAATTCGCCTAGTTTCGATTCGAGCAGTAATTTGTTCTCGAGTTCGTCTTCGAATTCGAGCAACGTGAGTTCGCCTTGTCTTGACATTGATAGCTTGGATTTCACGGAGAAGCCATGGGATGAAAGTGAAGCGTTCTTGTTGACGAAATATCCATCTTATGAGATTGATTGGGATGCTTTGTTGGCTTAG

Protein

Gene

Functional annotation

Database	accession number	e-value	annotation
nr	ABB89754.1	1.8e-66	dehydration-responsive element binding protein 3
Swissprot	Q9FJQ2.1	2.3e-45	Ethylene-responsive transcription factor ERF057
trEMBL	Q2VET5	1.3e-66	Dehydration-responsive element binding protein 3

Best hit in Arabidopsis

TAIR id	% identity	e-value	bit score	gene aliases	Short description
AT1G78080.1	49.06	2e-55	213	AtWIND1;RAP2.4;WIND1	related to AP2 4

>>>Show top 3 blast result

Query id	Subject id	alignment length	mis matches	gap openings	query start	query end	subject start	subject end	% identity	e-value	bit score
g256275	AT1G78080.1	265	106	7	85	335	85	334	49.06	2e-55	213
g256275	AT4G39780.1	334	124	12	3	333	2	266	41.32	3e-53	205
g256275	AT5G65130.1	320	137	11	17	333	4	273	40.62	5e-50	195

Ortholog group

Species	Genes
Allium cepa	g256275.t1
Allium fistulosum	AfisC8G02143
Allium sativum	Asa1G03062.1
Arabidopsis thaliana	AT2G22200.1; AT4G39780.1; AT5G65130.1
Oryza sativa	LOC_Os02g51670.1; LOC_Os08g31580.1; LOC_Os09g20350.1

Pfam domain

Pfam ID	Pfam name	type	alignment_start	alignment_end	bit_score	Evalue
PF00847.17	AP2	Domain	148	196	53.6	1.8e-14

Gene Ontology

Accession	Ontology	Name
GO:0003674	F	molecular_function
GO:0003700	F	transcription factor activity, sequence-specific DNA binding
GO:0006355	P	regulation of transcription, DNA-templated
GO:0008150	P	biological_process
GO:0009889	P	regulation of biosynthetic process
GO:0010468	P	regulation of gene expression
GO:0010556	P	regulation of macromolecule biosynthetic process
GO:0019219	P	regulation of nucleobase-containing compound metabolic process
GO:0019222	P	regulation of metabolic process
GO:0031323	P	regulation of cellular metabolic process
GO:0031326	P	regulation of cellular biosynthetic process
GO:0050789	P	regulation of biological process
GO:0050794	P	regulation of cellular process
GO:0051171	P	regulation of nitrogen compound metabolic process
GO:0051252	P	regulation of RNA metabolic process
GO:0060255	P	regulation of macromolecule metabolic process
GO:0065007	P	biological regulation
GO:0080090	P	regulation of primary metabolic process
GO:1903506	P	regulation of nucleic acid-templated transcription
GO:2000112	P	regulation of cellular macromolecule biosynthetic process
GO:2001141	P	regulation of RNA biosynthetic process
GO:0140110

KEGG pathway

KO	Name	Enzyme ID	Pathway	Pathway ID
K09286	EREBP; EREBP-like factor	EC:-	-	-

Expression pattern in different tissues

Expression pattern in BioProjects

Co-expression network