result

Gene information

Detail information of g290531

Location

Gene	Chr	Start	End	Strand
g290531	Scaffold_62889:HRSCAF_445975	98410	99866	+

Sequences

CDS

Protein

Gene

>g290531.t1
ATGAGACGATTCATAGTAATGAACAAGCTCAAGAAAGTAGCATTGAAGGTGACTGCAGCAGTGCATATTTTAAGACTTGTAACATATCAAATATTAGTATTCTCTGACAGTCTGATCCATTATGAATTTGTGTTCTCTTACAGGTGGTTGCGGAAAATCTTTCAGAAGAAGAAATCATTGGGTTGAAAGAAATGTTCAGATCAATGGACACAGATAACAGTGGTACAATAACGCTTAGTGAATTGAAAGATGGTCTTAGAAAATGGGGTGCAAAGCTTTCTGATTCGGAAGCAACACAATTGATGGAGTCGGTATGATTTAAGACTTTGTTTTGAGCATTCTGATATAATGGTATTTCCATACCAATATAATAGTAGAATTTGTGTATCAAATAAACTCTGATTGATGGTTCACTAACATTGGCACAAACATTGGATCCTCCATACGGGATAAATTACCATATGTGACTCCACAATTTTTTTTTCCATCAATGGGCAAAAAGCTTCCTCGTGTCAGCACAGACAAATTCTCCATTGTTGGAGTTGCATTTACAACTCTATGCAATGTTACAAATTTTGATAACGCATTCTTTATACAAAGAAGACTGAACTATGTTCTACCATGTTGTGCAACATAAACTTTACTTGCATGCAGGCTGATGTTGATGGCAATGGGACCATAGATTATATTGAATTCATAACAGCAACAATGCATATGAACAGAATGGAAAAGGAAGATCGTATATACAAATCATTCTTGTATTTTGATAAAGATAATAGTGGGTAAGTACATTTGCAACTGTTGCAGTTTTACTCTTTTTTATTTTTTAGTGATATGCTAGATATCATATTGAACACTGTTCATTAATTCCTTATGCAGGTACATCACATTGGAAGAGTTAAAACAAACTCTTGAGCAATATAATATGTTCGACGAACAAAAAATAAAGAATATACTTTCAGAAGTTGATACCGATTGTGTAAGTTTAAAATAACCCCTTCTTTACATGTACTTAACTCACAAATAAATGGTTTATCATTTGGTTATATTGTGTTTAAAAAAAAAATCATGAAGACAAAAATCCGATTCTACCATTAGACTTTGCACATGCTAAATAAAGCATTTTTATTACTTCTTTAAACCTGGTATGTTATTGATGATGTGATTTATAAACAACACAATTGTATTTAACACATCATATTTTCTGTGGTATTTTTATAGATTCATAACAATCAATGGTTGGGATAAAAAATGAGGCTTTTGATGTACCTTTGTTAGTACATATTTGTTCACGCATTACTTAAATATTATATTCGATTCTTTGATTTTTAGTTTCACAAACTGCTTATCTGTTAGCTATGTTATTATTTTTCTAGGATGGAAGAATCAACTATGAAGAGTTTGTTGCCATGATGAGAAGCGACAACCAAGATTTATTTCCAAATAGGAAGCTTTAA

Functional annotation

Database	accession number	e-value	annotation
nr	MBA0863679.1	1.8e-65	hypothetical protein
Swissprot	Q42479.1	2.4e-62	Calcium-dependent protein kinase isoform CDPK6
trEMBL	A0A7J9LZQ5	1.3e-65	Calcium-dependent protein kinase 3-like

Best hit in Arabidopsis

TAIR id	% identity	e-value	bit score	gene aliases	Short description
AT4G23650.1	65.32	9e-66	245	CDPK6;CPK3	calcium-dependent protein kinase 6

>>>Show top 3 blast result

Query id	Subject id	alignment length	mis matches	query start	query end	subject start	subject end	% identity	e-value	bit score
g290531	AT4G23650.1	173	60	1	173	355	527	65.32	9e-66	245
g290531	AT5G19360.1	173	63	1	173	345	517	63.58	2e-61	231
g290531	AT5G12180.1	173	65	1	173	350	522	62.43	1e-60	228

Ortholog group

Species	Genes
Allium cepa	g290531.t1; g389084.t1
Allium fistulosum	AfisC7G01054
Allium sativum	Asa3G04075.1; Asa5G06019.1
Arabidopsis thaliana
Oryza sativa	LOC_Os07g06740.3

Pfam domain

Pfam ID	Pfam name	type	alignment_start	alignment_end	bit_score	Evalue
PF13499.3	EF-hand_7	Domain	30	90	46.2	4.2e-12
PF13499.3	EF-hand_7	Domain	100	162	48.9	5.8e-13

Gene Ontology

Accession	Ontology	Name
GO:0005886	C	plasma membrane
GO:0005515	F	protein binding
GO:0005622	C	intracellular
GO:0005575	C	cellular_component
GO:0001101	P	response to acid chemical
GO:0008152	P	metabolic process
GO:0003674	F	molecular_function
GO:0016020	C	membrane
GO:0003824	F	catalytic activity
GO:0005773	C	vacuole
GO:0005829	C	cytosol
GO:0004672	F	protein kinase activity
GO:0004674	F	protein serine/threonine kinase activity
GO:0004683	F	calmodulin-dependent protein kinase activity
GO:0007165	P	signal transduction
GO:0035556	P	intracellular signal transduction
GO:0005488	F	binding
GO:0005516	F	calmodulin binding
GO:0005623	C	cell
GO:0005634	C	nucleus
GO:0005737	C	cytoplasm
GO:0043231	C	intracellular membrane-bounded organelle
GO:0006464	P	cellular protein modification process
GO:0006468	P	protein phosphorylation
GO:0006793	P	phosphorus metabolic process
GO:0006796	P	phosphate-containing compound metabolic process
GO:0006807	P	nitrogen compound metabolic process
GO:0006950	P	response to stress
GO:0006970	P	response to osmotic stress
GO:0007154	P	cell communication
GO:0008150	P	biological_process
GO:0009628	P	response to abiotic stimulus
GO:0009651	P	response to salt stress
GO:0009719	P	response to endogenous stimulus
GO:0009725	P	response to hormone
GO:0009737	P	response to abscisic acid
GO:0009738	P	abscisic acid-activated signaling pathway
GO:0009755	P	hormone-mediated signaling pathway
GO:0009931	F	calcium-dependent protein serine/threonine kinase activity
GO:0009987	P	cellular process
GO:0010033	P	response to organic substance
GO:0010119	P	regulation of stomatal movement
GO:0010359	P	regulation of anion channel activity
GO:0010857	F	calcium-dependent protein kinase activity
GO:0016301	F	kinase activity
GO:0016310	P	phosphorylation
GO:0016740	F	transferase activity
GO:0016772	F	transferase activity, transferring phosphorus-containing groups
GO:0016773	F	phosphotransferase activity, alcohol group as acceptor
GO:0018105	P	peptidyl-serine phosphorylation
GO:0018193	P	peptidyl-amino acid modification
GO:0018209	P	peptidyl-serine modification
GO:0019538	P	protein metabolic process
GO:0022898	P	regulation of transmembrane transporter activity
GO:0023052	P	signaling
GO:0070887	P	cellular response to chemical stimulus
GO:0032409	P	regulation of transporter activity
GO:0032412	P	regulation of ion transmembrane transporter activity
GO:0032870	P	cellular response to hormone stimulus
GO:0032879	P	regulation of localization
GO:0033993	P	response to lipid
GO:0034762	P	regulation of transmembrane transport
GO:0034765	P	regulation of ion transmembrane transport
GO:0036211	P	protein modification process
GO:0042221	P	response to chemical
GO:0043170	P	macromolecule metabolic process
GO:0043226	C	organelle
GO:0043227	C	membrane-bounded organelle
GO:0043229	C	intracellular organelle
GO:0043269	P	regulation of ion transport
GO:0043412	P	macromolecule modification
GO:0044070	P	regulation of anion transport
GO:0044237	P	cellular metabolic process
GO:0044238	P	primary metabolic process
GO:0044260	P	cellular macromolecule metabolic process
GO:0044267	P	cellular protein metabolic process
GO:0044424	C	intracellular part
GO:0044444	C	cytoplasmic part
GO:0044464	C	cell part
GO:0046777	P	protein autophosphorylation
GO:0050789	P	regulation of biological process
GO:0050794	P	regulation of cellular process
GO:0050896	P	response to stimulus
GO:0051049	P	regulation of transport
GO:0051716	P	cellular response to stimulus
GO:0065007	P	biological regulation
GO:0065009	P	regulation of molecular function
GO:0071215	P	cellular response to abscisic acid stimulus
GO:0071229	P	cellular response to acid chemical
GO:0071310	P	cellular response to organic substance
GO:0071396	P	cellular response to lipid
GO:0071495	P	cellular response to endogenous stimulus
GO:0071704	P	organic substance metabolic process
GO:0071944	C	cell periphery
GO:0097305	P	response to alcohol
GO:0097306	P	cellular response to alcohol
GO:1901564	P	organonitrogen compound metabolic process
GO:1901700	P	response to oxygen-containing compound
GO:1901701	P	cellular response to oxygen-containing compound
GO:1903959	P	regulation of anion transmembrane transport
GO:0140096

KEGG pathway

KO	Name	Enzyme ID	Pathway	Pathway ID
K13412	CPK; calcium-dependent protein kinase	EC:2.7.11.1	Plant-pathogen interaction	ko04626

Expression pattern in different tissues

Expression pattern in BioProjects

Co-expression network