result

Gene information

Detail information of g292120

Location

Gene	Chr	Start	End	Strand
g292120	Scaffold_63156:HRSCAF_446242	442123	443858	+

Sequences

CDS

Protein

Gene

>g292120.t1
ATGAGCCTACCTCCTGGTTTCAGGTTTCATCCTACGGATGAAGAGCTTGTTGCATATTATCTTAAAAGGAAGATCAACAGGAGAAAAATTGAGTTGGAAGTAATTCAAGAAGTAGACCTCTATAAGTGTGAGCCATGGGAATTACCAGGTAAACTAGCTATATGTCTTGAATTTATTTTACTTCTTGTATGATATTATATCTATATTTTACATTGTTTGTCAAAAGAAAAAAAGAAGTTAATGGATAACCAATCACACATGCTAGTTTATGTCTGAAACATCTTGGTAAAGAATTAAGTTTGTAAGTACAGCAAATTAATCAGCAAAAAAAATTAAAAAAATAATAATAATCTGCACACATCTACTATTTCTTTACAGTTTGTAATAATTATCCAATTTTTTTAGAAGAAGCGTTCCAAGCCTAATAGTATTCCAACACATGTTATCTTGTAATCAAGAGTATATAGAAACTAAATAAATATATCGATGCAGAAAAATCATTCTTGCCAAGTAAAGATTTAGAGTGGTTCTTCTTCAGTCCTAGAGACCGAAAGTACCCCAATGGGTCAAGAACAAACAGGGCAACACAAGCTGGGTATTGGAAGGCTACCGGTAAGGATAGAAAAGTGTATTCTCAAAAAATAAGCATTGGTACAAAGAAAACACTAGTTTACTACAGAGGAAGAGCACCCCACGGCTCAAGAACGGATTGGATAATGCATGAGTATCAACTTGATGAAAGCGAGTGTGAAACCCCCAGCTCCGGTTTACAGGTAAAGTACCATTTTGGAGAAATTCTATCAAATATCCCTTTTTAACTATTAGCATTTAGATTGACATCGATGCTTTGACCAGATAATGTCTTTTGGCATAAATTTACATTATGTCTTTAATTTAACAAATAATGTTTTTTCTAGGATGTGTATGCTTTGTGCCGCGTATGTAAGAGAAATGCACCAGGGCCAGTGATCATAGCAGAAAAATCAAACAGCTATTCATTACAGTATGAATCAAACTCCTCGCGGATAATCCAAAAACCTATGAATTGTGTAGAAGGAAAGTGGATGCAGTTCCTAGACGAAGATGCATTTGATGCTAATGTTTCTCCTTTTCAAGATAGTTCCAGTTTTCCTTATGTGCCCTCTGAGGTATAATTTAGGACCAAATTTCTATTGAGAATATCGGTTTAACTAGATGCAAAATTGTTTCTTATTCATTTGCTGCAAGGAAACTCGTCTTTATGCAAAATTTAACATAAATTTTGTGGAAAACACTGAAGATAATAAGAAAAAATAAATGAAATATGCTGACAGTTAGTTGCTCATATAAGTTAAGTTGCTTAACAAAATTGGTACCCAAAAAATAAGCTACACTTCAAACATTTCATTTCCAGCTAATGATATTACATTAAACATTTCTGTTGAATGATGCAGGTGGATGTGCTTGCACTAGAATGGACAAAGGATATGGAACCATTTGATCTGCAAGGTGCAAAAATGTTTCATTCCGAGTACGTTCAACAAAATACTACAGAGGATGACATGAATAATACTTATAGACACGACGATAACTTGTTAAATGGGAACATCAATACACATTTTGAAGAATTCACCTCATTACTGGAAACAAAACATGAAGGGGTTGATGATCATGAGTTGTTTAGCATGATGGATTGCTTGGATTCTACTAGTTTTTTGGAAGCTATAAACTCTGAAGGTAATTTGAGGGATGACTAG

Functional annotation

Database	accession number	e-value	annotation
nr	XP_020248886.1	2.4e-95	NAC domain-containing protein 86-like isoform X1
Swissprot	A4VCM0.1	2.0e-70	NAC domain-containing protein 45
trEMBL	A0A5P1E0H8	1.7e-95	NAC domain-containing protein

Best hit in Arabidopsis

TAIR id	% identity	e-value	bit score	gene aliases	Short description
AT1G65910.1	51.85	6e-78	287	anac028;NAC028	NAC domain containing protein 28

>>>Show top 3 blast result

Query id	Subject id	alignment length	mis matches	gap openings	query start	query end	subject start	subject end	% identity	e-value	bit score
g292120	AT1G65910.1	297	96	7	1	255	4	295	51.85	6e-78	287
g292120	AT5G17260.1	154	34	0	1	154	4	157	77.92	1e-72	270
g292120	AT3G03200.1	154	34	0	1	154	4	157	77.92	3e-72	268

Ortholog group

Species	Genes
Allium cepa	g292120.t1
Allium fistulosum	AfisC3G05994
Allium sativum	Asa2G04977.1
Arabidopsis thaliana
Oryza sativa

Pfam domain

Pfam ID	Pfam name	type	alignment_start	alignment_end	bit_score	Evalue
PF02365.12	NAM	Family	4	130	101.1	4.2e-29

Gene Ontology

Accession	Ontology	Name
GO:0005622	C	intracellular
GO:0005575	C	cellular_component
GO:0001067	F	regulatory region nucleic acid binding
GO:0003674	F	molecular_function
GO:0003676	F	nucleic acid binding
GO:0003677	F	DNA binding
GO:0003700	F	transcription factor activity, sequence-specific DNA binding
GO:0005488	F	binding
GO:0005623	C	cell
GO:0005634	C	nucleus
GO:0005737	C	cytoplasm
GO:0043231	C	intracellular membrane-bounded organelle
GO:0006355	P	regulation of transcription, DNA-templated
GO:0008150	P	biological_process
GO:0009314	P	response to radiation
GO:0009416	P	response to light stimulus
GO:0009628	P	response to abiotic stimulus
GO:0009642	P	response to light intensity
GO:0009644	P	response to high light intensity
GO:0009889	P	regulation of biosynthetic process
GO:0009891	P	positive regulation of biosynthetic process
GO:0009893	P	positive regulation of metabolic process
GO:0009962	P	regulation of flavonoid biosynthetic process
GO:0009987	P	cellular process
GO:0010468	P	regulation of gene expression
GO:0010556	P	regulation of macromolecule biosynthetic process
GO:0010557	P	positive regulation of macromolecule biosynthetic process
GO:0010604	P	positive regulation of macromolecule metabolic process
GO:0010628	P	positive regulation of gene expression
GO:0044212	F	transcription regulatory region DNA binding
GO:0016043	P	cellular component organization
GO:0045935	P	positive regulation of nucleobase-containing compound metabolic process
GO:0045893	P	positive regulation of transcription, DNA-templated
GO:0019219	P	regulation of nucleobase-containing compound metabolic process
GO:0019222	P	regulation of metabolic process
GO:0022411	P	cellular component disassembly
GO:0030154	P	cell differentiation
GO:0031323	P	regulation of cellular metabolic process
GO:0031325	P	positive regulation of cellular metabolic process
GO:0031326	P	regulation of cellular biosynthetic process
GO:0031328	P	positive regulation of cellular biosynthetic process
GO:0032502	P	developmental process
GO:0043226	C	organelle
GO:0043227	C	membrane-bounded organelle
GO:0043229	C	intracellular organelle
GO:0044424	C	intracellular part
GO:0044464	C	cell part
GO:0048518	P	positive regulation of biological process
GO:0048522	P	positive regulation of cellular process
GO:0048869	P	cellular developmental process
GO:0050789	P	regulation of biological process
GO:0050794	P	regulation of cellular process
GO:0050896	P	response to stimulus
GO:0051171	P	regulation of nitrogen compound metabolic process
GO:0051173	P	positive regulation of nitrogen compound metabolic process
GO:0051252	P	regulation of RNA metabolic process
GO:0051254	P	positive regulation of RNA metabolic process
GO:0060255	P	regulation of macromolecule metabolic process
GO:0065007	P	biological regulation
GO:0071840	P	cellular component organization or biogenesis
GO:0080090	P	regulation of primary metabolic process
GO:0090601	P	enucleation
GO:0090602	P	sieve element enucleation
GO:0090603	P	sieve element differentiation
GO:0097159	F	organic cyclic compound binding
GO:1901363	F	heterocyclic compound binding
GO:1902680	P	positive regulation of RNA biosynthetic process
GO:1903506	P	regulation of nucleic acid-templated transcription
GO:1903508	P	positive regulation of nucleic acid-templated transcription
GO:2000112	P	regulation of cellular macromolecule biosynthetic process
GO:2001141	P	regulation of RNA biosynthetic process
GO:0140110

KEGG pathway

KO	Name	Enzyme ID	Pathway	Pathway ID
-	-	-	-	-

Expression pattern in different tissues

Expression pattern in BioProjects

Co-expression network