result

Gene information

Detail information of g297035

Location

Gene	Chr	Start	End	Strand
g297035	Scaffold_63844:HRSCAF_446930	21959	22996	-

Sequences

CDS

>g297035.t1
ATGGATCAATCCGAAGGAAGCAACACCACCACTTCTTTAGACTTGGCCGACCCTTCCATAACTAATTCAGCGCCAGCGGTGTCCATCACCGCAGCCCCAAAAAGATCAAACAAAGACCGACATATCAAAGTTGACGGCCGTGGTCGTCGGATCCGCATGCCCGCCGTCTGCGCAGCCCGCGTTTTCCAGCTCACCCGGGAGCTGGGCCACAAGTCCGACGGGGAAACCATCGAGTGGCTCCTCCACCATGCCGAGCCATCCATCATCGCCGCCACCGGCACAGGAACCATCCCCGCCAACTTCTCCTCTCTGAAAATCCCCCACCGCACCAGCGCCGCCTCCTTCTCCGCGCCTAATTCGTCCAAGCCCGCTCCCCACTCCTTCCACTTCCCCTACGCTCTCAACCCCCAACTTCATCAGTGCGACGGCGGAGGATCTTCTTTTGTGGGCTTCCACGAGCATCCGCACCAACAACCGCCCTCGCTGACGTCTCATCCCCCCGGAGAGGGAAACGTGGACGGAAGTAATCACACCAGAAAGCGGTTCAAAGAGAAAGAAAGGCTGACCTCGTCGGAGCGGGGGGAGAAGCGGACAAGGGCGAACGTGGCACAAGCAACCGCAATGTGGGCGGTGGGGCCCACAACGAGCGGGGGTGGAGGAGCCTTCTGGATGCTCCCTGTCTCCACTGGATCAAACTGCAATCCCACGGAAGGCAGTAATAATGCTAGTGCTAATAATTTGCCAATGTGGACGCTGCCTTCGCTGCCTGTGGCCCCTCCGTTCGGGACGGCCGGGAGGGCGAACGCTGTACAGGCGCCGGTGCAGTTTATGTCGAGAGTGGCTGCTATGCCGTCCATGACGTCCATGTTGGTGGGTGTGGCTTCGCCTCAGGCTCATTTGGGTTTGGGCATGGACACTAATTTTAACACGGTTGCTGCACTTAATGGTGCTTATGGTTCTGGAAGACTTAATGTCGATTCGGAGCAGGAGCAGCAAGGGAATGGTAGCATCGATGATCCACAAACTGCTTCTCGGTGA

Protein

Gene

Functional annotation

Database	accession number	e-value	annotation
nr	KAA8536570.1	2.9e-51	hypothetical protein F0562_029048
Swissprot	Q9C518.1	5.6e-39	Transcription factor TCP8
trEMBL	A0A834ZQX1	3.5e-54	TCP domain-containing protein

Best hit in Arabidopsis

TAIR id	% identity	e-value	bit score	gene aliases	Short description
AT1G58100.1	41.47	5e-51	198	TCP8	TCP family transcription factor

>>>Show top 3 blast result

Query id	Subject id	alignment length	mis matches	gap openings	query start	query end	subject start	subject end	% identity	e-value	bit score
g297035	AT1G58100.1	340	160	11	34	339	57	391	41.47	5e-51	198
g297035	AT1G35560.1	292	109	11	34	309	52	297	41.44	2e-40	163
g297035	AT1G72010.1	323	137	13	29	321	55	344	38.08	5e-37	151

Ortholog group

Species	Genes
Allium cepa	g297035.t1; g530956.t1
Allium fistulosum	AfisC2G08267; AfisC6G02078
Allium sativum	Asa8G05622.1
Arabidopsis thaliana	AT1G35560.1; AT1G58100.1; AT1G58100.2; AT1G72010.1
Oryza sativa	LOC_Os11g07460.1

Pfam domain

Pfam ID	Pfam name	type	alignment_start	alignment_end	bit_score	Evalue
PF03634.10	TCP	Family	36	199	121.4	4.4e-35

Gene Ontology

Accession	Ontology	Name
GO:0000976	F	transcription regulatory region sequence-specific DNA binding
GO:0000977	F	RNA polymerase II regulatory region sequence-specific DNA binding
GO:0000978	F	RNA polymerase II core promoter proximal region sequence-specific DNA binding
GO:0000987	F	core promoter proximal region sequence-specific DNA binding
GO:0001012	F	RNA polymerase II regulatory region DNA binding
GO:0001067	F	regulatory region nucleic acid binding
GO:0003674	F	molecular_function
GO:0003676	F	nucleic acid binding
GO:0003677	F	DNA binding
GO:0003690	F	double-stranded DNA binding
GO:0003700	F	transcription factor activity, sequence-specific DNA binding
GO:0005488	F	binding
GO:0006355	P	regulation of transcription, DNA-templated
GO:0008150	P	biological_process
GO:0009889	P	regulation of biosynthetic process
GO:0010468	P	regulation of gene expression
GO:0010556	P	regulation of macromolecule biosynthetic process
GO:0044212	F	transcription regulatory region DNA binding
GO:0019219	P	regulation of nucleobase-containing compound metabolic process
GO:0019222	P	regulation of metabolic process
GO:0031323	P	regulation of cellular metabolic process
GO:0031326	P	regulation of cellular biosynthetic process
GO:0043565	F	sequence-specific DNA binding
GO:0050789	P	regulation of biological process
GO:0050794	P	regulation of cellular process
GO:0051171	P	regulation of nitrogen compound metabolic process
GO:0051252	P	regulation of RNA metabolic process
GO:0060255	P	regulation of macromolecule metabolic process
GO:0065007	P	biological regulation
GO:0080090	P	regulation of primary metabolic process
GO:0097159	F	organic cyclic compound binding
GO:1901363	F	heterocyclic compound binding
GO:1903506	P	regulation of nucleic acid-templated transcription
GO:1990837	F	sequence-specific double-stranded DNA binding
GO:2000112	P	regulation of cellular macromolecule biosynthetic process
GO:2001141	P	regulation of RNA biosynthetic process
GO:0140110

KEGG pathway

KO	Name	Enzyme ID	Pathway	Pathway ID
-	-	-	-	-

Expression pattern in different tissues

Expression pattern in BioProjects

Co-expression network