result

Gene information

Detail information of g315965

Location

Gene	Chr	Start	End	Strand
g315965	CHR1	82668529	82669526	+

Sequences

CDS

Protein

Gene

>g315965.t1
ATGGGGAGGTCACCATGTTGTGATAGAGAAGCAAATGTGAAAAAAGGACCATGGACTACTGAAGAAGATACAAAACTTATGGAGTATATACAGAAGCATGGTTGTGGCAATTGGCGCAATTTGCCAAAAAATGCTGGGCTTAATCGATGTGGGAAAAGTTGCAGACTTCGATGGACTAACTACCTTCGACCTGATATAAAACGAGGAAGGTTTACTGAAGACGAAGAGCAACTTATCATTCAGCTTCATTCTGTCCTTGGAAATAAGTAAGTAATCAATCACTCAACAATTCTTTAACTTTTATCTATGGTGCAAATGAATAAAACTAACATATTTGTATTATATATAGGTGGTCAATGATAGCCGCAAGATTACCAGGGAGAACAGATAATGAAATAAAGAACTACTGGAACACGCACCTGAGAAAGAAGCTGCTAATAATGGGTATCGATCCAGTAACGCACAGGCCAAGATCAGATCACCTTAATCTACTCTCAGACCTGCAAAACTACACAAATTTTGCAACGAATCCATTAATCAACAACGCCATTCAGCTTCAGAAGTTACAGCTTTTTCAAACTCTGATCCAAGTTATTGCAAACAATTCTGCAAATGCTAAAAACCTCATGACATCAAATAATATGTTTTCAAATGTTGCAAATGATTTTGTTCCATCGATGAATTATGGGGATCGCACATTGGACTTTGACTCGGTGCCATCTATGACTGCAGAAGTATCAGAGAATGGTTTGATTGATCAAGTGCAATTAGATGCATTCAATTTGAGTGCAAGTAGTTCACCAAATTCAGCACCTTTAGAGATTAATGGTGGATTAACTCTTGATGATGTTGACATAGATGATTTTGGATGGAAAGATATTTTAGAGTAAGCAATCTTTCCTTAATTTTACTGATTTTTCCCAATATTTTCTAATGAGATATGATGTTGATTTGTACGTGTTCGTTGATTTTGCAGTCATATATCTTGGTCAGGGTGA

Functional annotation

Database	accession number	e-value	annotation
nr	XP_020240778.1	9.7e-82	transcription factor MYB39-like
Swissprot	Q9M0Y5.1	9.8e-63	Myb-related protein 74
trEMBL	A0A6I9RXD8	1.5e-68	transcription factor MYB41-like

Best hit in Arabidopsis

TAIR id	% identity	e-value	bit score	gene aliases	Short description
AT5G16770.1	56.45	1e-70	262	AtMYB9;MYB9	myb domain protein 9

>>>Show top 3 blast result

Query id	Subject id	alignment length	mis matches	gap openings	query start	query end	subject start	subject end	% identity	e-value	bit score
g315965	AT5G16770.2	248	98	4	1	240	1	246	56.45	1e-70	262
g315965	AT5G16770.1	248	98	4	1	240	1	246	56.45	1e-70	262
g315965	AT3G02940.1	198	64	3	1	188	1	197	62.12	3e-66	248

Ortholog group

Species	Genes
Allium cepa	g315965.t1
Allium fistulosum	AfisC1G06286
Allium sativum	Asa0G03699.1
Arabidopsis thaliana	AT3G02940.1
Oryza sativa

Pfam domain

Pfam ID	Pfam name	type	alignment_start	alignment_end	bit_score	Evalue
PF00249.28	Myb_DNA-binding	Domain	15	62	61.3	6.5e-17
PF00249.28	Myb_DNA-binding	Domain	68	113	58.6	4.5e-16

Gene Ontology

Accession	Ontology	Name
GO:0005622	C	intracellular
GO:0005575	C	cellular_component
GO:0000981	F	RNA polymerase II transcription factor activity, sequence-specific DNA binding
GO:0000988	F	transcription factor activity, protein binding
GO:0000989	F	transcription factor activity, transcription factor binding
GO:0001067	F	regulatory region nucleic acid binding
GO:0001076	F	transcription factor activity, RNA polymerase II transcription factor binding
GO:0001134	F	transcription factor activity, transcription factor recruiting
GO:0001135	F	transcription factor activity, RNA polymerase II transcription factor recruiting
GO:0003674	F	molecular_function
GO:0003676	F	nucleic acid binding
GO:0003677	F	DNA binding
GO:0003700	F	transcription factor activity, sequence-specific DNA binding
GO:0005488	F	binding
GO:0005623	C	cell
GO:0005634	C	nucleus
GO:0043231	C	intracellular membrane-bounded organelle
GO:0006355	P	regulation of transcription, DNA-templated
GO:0006357	P	regulation of transcription from RNA polymerase II promoter
GO:0008150	P	biological_process
GO:0009889	P	regulation of biosynthetic process
GO:0009987	P	cellular process
GO:0010468	P	regulation of gene expression
GO:0010556	P	regulation of macromolecule biosynthetic process
GO:0044212	F	transcription regulatory region DNA binding
GO:0019219	P	regulation of nucleobase-containing compound metabolic process
GO:0019222	P	regulation of metabolic process
GO:0030154	P	cell differentiation
GO:0031323	P	regulation of cellular metabolic process
GO:0031326	P	regulation of cellular biosynthetic process
GO:0032502	P	developmental process
GO:0043226	C	organelle
GO:0043227	C	membrane-bounded organelle
GO:0043229	C	intracellular organelle
GO:0043565	F	sequence-specific DNA binding
GO:0044424	C	intracellular part
GO:0044464	C	cell part
GO:0048869	P	cellular developmental process
GO:0050789	P	regulation of biological process
GO:0050794	P	regulation of cellular process
GO:0051171	P	regulation of nitrogen compound metabolic process
GO:0051252	P	regulation of RNA metabolic process
GO:0060255	P	regulation of macromolecule metabolic process
GO:0065007	P	biological regulation
GO:0080090	P	regulation of primary metabolic process
GO:0097159	F	organic cyclic compound binding
GO:1901363	F	heterocyclic compound binding
GO:1903506	P	regulation of nucleic acid-templated transcription
GO:2000112	P	regulation of cellular macromolecule biosynthetic process
GO:2001141	P	regulation of RNA biosynthetic process
GO:0140110

KEGG pathway

KO	Name	Enzyme ID	Pathway	Pathway ID
K09422	MYBP; transcription factor MYB, plant	EC:-	-	-

Expression pattern in different tissues

Expression pattern in BioProjects

Co-expression network