result

Gene information

Detail information of g324974

Location

Gene	Chr	Start	End	Strand
g324974	Scaffold_67579:HRSCAF_450665	367612	369283	-

Sequences

CDS

Protein

Gene

>g324974.t1
ATGGAGGAACAAGTGATTAGTAGTGCTCACCGCATGGGTGCTACTCGACCAATATACGTGGAGACCTTAGCAATGCGTGGAACCATCGAACAACAAATGCAAGAATTCTTACAAGTGCTCATGTATTCTGATTACACATAATTTGACAGTACACATAATGAGGCAGATGCGTACACATAGACATTTGTAATCGGCAAATACAGATTGACCTTATCTAACAGAATGCGAGCACGAGCAGAAGAGTACTAAATCAAGAGATAGATGTAATGATAGCTGAGATAGTTTTCTTAATAGAAAACATCGATGGTCGATGCCAACCTAAAATGTTGATTACATGTGTCTTATTAAACAGCATATCCATCGTCCGTTGCCCTAGGCAGGATATGAATCAAGTGAGCCTGATAAAATATGCGGGAGACACACTCGTAAAGCTCGTGCGGCTGAAGTTCATAACTTGTCAGAGCGGGTAATTTTTTTTATTGATCATCTTTGCAAGGATGTTAAAATTAATCTTTTTTCTATCTTTTACTAAACTTATGATGACTTTAATTAACTTACGCAGAGAAGAAGAGATAGGATCAATGACAAGATGAAAGCATTGCAAGAATTACATCCACACTGTAACAAGGTCCATTATAATACACAGGAAAAATAACTTTTATATAATAACATTTTCACCTCCATTTATATATTTTTTTTGTCACCCTGCATGTACAGCATATAGCAAGTGGAATCCGTATCAAAATAGCCAGCATTTTATGTTTATTTATTGATATTTTCGCTTTCACACATTTTCGCTGTTATACATGCTAAGAACAACTGATTCAAGACCTTCAAAATTAGTCACCCAATGATACATCTGAAGCATGTGTAGAGTTTTTAGTGCATATTCCTTCGAAGTTTACATTATTAAGCTTGGCTCTTAGAGTTTTCAAAGTTGCCTTATCTCTATAACAGAATTTTCTATTATGTATCACAAATTGTCAAAATTACACCGTGTATAAGGAATGAAAATTAGAAGAGAGCTTTGGAAGGATATATCTGATATTTCCTATGTTTAATACAGAAGTCGCTTGTGTTACGACTTATAAAAGAAAACATTTTTCTGATATATGAATACATCAATATTTTGCAGACAGACAAAGCATCGATGCTGGATGAGGCAATAGAGTATTTAAAGTCACCGCAACTGCAACTTCAGGTTCAAAATAACCATGATACATCCAATGGTTCGTATTTAAGTTAAAAACCTAACACAACACAACATGTAATACCCTTGTTTGTTTTATTATTAGTTATTGTGGATGGGAAGTGGCATGGCACCAATGGGGTTTCCAAGTATGCAACAGTACATGTCTGGAGTAAACATGGGAACGAGTCATGCTTCTTCTCTGCCTTCTATTGATTACACAATACAATCATCGACAAACCCACAGGTTAATAATATTATACCAGCAAGTTCTTATAATTTCCCCACTCAAACGTAAAATATCCAGCTTCCAATAGGATCATATGCCCCGTATCTCCAATTCCCTCACATGCAAATCTATTGGTTGCATTTCAGATATATGGTTTAACAGCATATCCATCATCCGTTGCCCTAGGCGGCCGCCTTGGCAGCCTTGCCTTAGGGCTGGCCCTGGATGTGCTATTCGAAGAGGCTGGATTTTGA

Functional annotation

Database	accession number	e-value	annotation
nr	XP_020256190.1	1.6e-33	transcription factor PIF4-like isoform X2
Swissprot	Q10CH5.1	3.3e-28	OsPIL1
trEMBL	A0A8B7D2R7	5.0e-34	transcription factor PIF4-like isoform X8

Best hit in Arabidopsis

TAIR id	% identity	e-value	bit score	gene aliases	Short description
AT2G20180.1	60.19	1e-26	115	PIF1;PIL5	phytochrome interacting factor 3-like 5

>>>Show top 3 blast result

Query id	Subject id	alignment length	mis matches	query start	query end	subject start	subject end	% identity	e-value	bit score
g324974	AT2G20180.1	103	41	48	150	203	305	60.19	1e-26	115
g324974	AT2G20180.3	103	41	48	150	274	376	60.19	2e-26	115
g324974	AT2G20180.2	103	41	48	150	274	376	60.19	2e-26	115

Ortholog group

Species	Genes
Allium cepa	g324974.t1; g465113.t1; g523729.t1
Allium fistulosum	AfisC3G07095
Allium sativum	Asa0G03798.1
Arabidopsis thaliana
Oryza sativa

Pfam domain

Pfam ID	Pfam name	type	alignment_start	alignment_end	bit_score	Evalue
PF00010.23	HLH	Domain	62	106	46.1	3.1e-12

Gene Ontology

Accession	Ontology	Name
GO:0005622	C	intracellular
GO:0005575	C	cellular_component
GO:0005623	C	cell
GO:0005634	C	nucleus
GO:0043231	C	intracellular membrane-bounded organelle
GO:0006355	P	regulation of transcription, DNA-templated
GO:0007275	P	multicellular organism development
GO:0007389	P	pattern specification process
GO:0008150	P	biological_process
GO:0009889	P	regulation of biosynthetic process
GO:0009891	P	positive regulation of biosynthetic process
GO:0009893	P	positive regulation of metabolic process
GO:0009966	P	regulation of signal transduction
GO:0009968	P	negative regulation of signal transduction
GO:0010468	P	regulation of gene expression
GO:0010556	P	regulation of macromolecule biosynthetic process
GO:0010557	P	positive regulation of macromolecule biosynthetic process
GO:0010604	P	positive regulation of macromolecule metabolic process
GO:0010628	P	positive regulation of gene expression
GO:0010646	P	regulation of cell communication
GO:0010648	P	negative regulation of cell communication
GO:0045935	P	positive regulation of nucleobase-containing compound metabolic process
GO:0045893	P	positive regulation of transcription, DNA-templated
GO:0019219	P	regulation of nucleobase-containing compound metabolic process
GO:0019222	P	regulation of metabolic process
GO:0023051	P	regulation of signaling
GO:0023057	P	negative regulation of signaling
GO:0031323	P	regulation of cellular metabolic process
GO:0031325	P	positive regulation of cellular metabolic process
GO:0031326	P	regulation of cellular biosynthetic process
GO:0031328	P	positive regulation of cellular biosynthetic process
GO:0032501	P	multicellular organismal process
GO:0032502	P	developmental process
GO:0043226	C	organelle
GO:0043227	C	membrane-bounded organelle
GO:0043229	C	intracellular organelle
GO:0044424	C	intracellular part
GO:0044464	C	cell part
GO:0048367	P	shoot system development
GO:0048518	P	positive regulation of biological process
GO:0048519	P	negative regulation of biological process
GO:0048522	P	positive regulation of cellular process
GO:0048523	P	negative regulation of cellular process
GO:0048583	P	regulation of response to stimulus
GO:0048585	P	negative regulation of response to stimulus
GO:0048731	P	system development
GO:0048856	P	anatomical structure development
GO:0050789	P	regulation of biological process
GO:0050794	P	regulation of cellular process
GO:0051171	P	regulation of nitrogen compound metabolic process
GO:0051173	P	positive regulation of nitrogen compound metabolic process
GO:0051252	P	regulation of RNA metabolic process
GO:0051254	P	positive regulation of RNA metabolic process
GO:0060255	P	regulation of macromolecule metabolic process
GO:0065007	P	biological regulation
GO:0080006	P	internode patterning
GO:0080090	P	regulation of primary metabolic process
GO:0090227	P	regulation of red or far-red light signaling pathway
GO:0090229	P	negative regulation of red or far-red light signaling pathway
GO:1902680	P	positive regulation of RNA biosynthetic process
GO:1903506	P	regulation of nucleic acid-templated transcription
GO:1903508	P	positive regulation of nucleic acid-templated transcription
GO:2000030	P	regulation of response to red or far red light
GO:2000112	P	regulation of cellular macromolecule biosynthetic process
GO:2001141	P	regulation of RNA biosynthetic process

KEGG pathway

KO	Name	Enzyme ID	Pathway	Pathway ID
K16189	PIF4; phytochrome-interacting factor 4	EC:-	Plant hormone signal transduction	ko04075

Expression pattern in different tissues

Expression pattern in BioProjects

Co-expression network