result

Gene information

Detail information of g352230

Location

Gene	Chr	Start	End	Strand
g352230	Scaffold_70822:HRSCAF_453908	70526	71749	-

Sequences

CDS

>g352230.t1
ATGGAAATCGAACAAAACCACAATCATAACGGTAGCAACTACAAAAGAACTCGTGGCAGCATGAGAGGAACTCACGTGAATCAAGAAGAAGATGAAGAAGATGCAGAACCAAAAGGACCGGAACTTGCCATTGTGGACTGCGCAAACAATGATCGCATGCGCTCATGGCATCTTCCATCTTCTAGAATATACAGAGTTTCCCGTGCTACGGGTGGAAAAGATCGCCATAGCAAAGTTTACACTTCAAAAGGATTGAGAGATCGAAGGGTTAGGCTTTCTGTTTCAACTGCCATTCAGTTTTATGATCTTCAGGATAGACTTGGTTATGATCAACCAAGTAAAGCAATAGAATGGTTGATCAAAGCTGCACAATCTGCTATTGATGAGCTTCCCTCTCTTGATACTAGTAAATTCATGGATCTTGCAAATCAACAAGTTATTGATCCGGAACCCGAACTTGGTTACAACAATAATACTTATTACAACTATAATAATCAACAGCAGAATAGTAGTACTTCCGAAACTAGCAAAGGTTCAGTACTATCATTGTCTAGGTCTGAAACTAGAGTAAAAGCTAGAGAAAGAGCGAGAGAAAGAGTGAAGGATAAAGAAAAGGATAGCATGGATGATGACACTCAGGTTGATCCTAGCTTGAACTCACAAGGATCTTTCACTAAACTTCTTACTGGAGACACAAATGGACAAGCTAGTTCTAGCGCAAGTTTCATCCAGAAACATATGCAGAATTTGTCTCCTGTATCTTCAACTGCTGATTACTTTAGTACTCAATCCGGGTTTTCTTCACAAACACATTTTGAGAATAACAATAGCAACAACAGTGTTTCTCCAGTTGGAATGGTGCCATTAATCAACAATGGTGGTGACCAACAGTTTGCATTCATGCAAGATCATTTCTTTCAAGGAGATTATAATTTGAACTTTTCTATTTCGCCAATATCTGGTTTCCATAGGGGGACCCTTCAGTCCAATCCACCAAATCACCACCAAATTTCTCATAATCACAACCATCATCAATTCCTTCAGACTAATGCACAAAGACTTTCTTTGGGGTTAGAACGATCGAGCGTGTCGATGCCTGTGCATGTGCCTTTCTTCTTCGGAACTGCAGCAAATGGGTCTTCTTCGCCCAGTGAGAACCAGTATGCATCTGGGTTTGATGGGCATTTGCAGCATCTTGAAATCAAAGGGAAGGGAAAAGGTTAA

Protein

Gene

Functional annotation

Database	accession number	e-value	annotation
nr	XP_020272757.1	3.7e-61	transcription factor TCP2
Swissprot	Q93V43.1	2.7e-32	Protein TEOSINTE-LIKE1, CYCLOIDEA, and PROLIFERATING CELL FACTOR 2
trEMBL	A0A5P1EH11	2.7e-61	TCP domain-containing protein

Best hit in Arabidopsis

TAIR id	% identity	e-value	bit score	gene aliases	Short description
AT4G18390.1	44.30	4e-51	199	TCP2;TCP2	TEOSINTE BRANCHED 1, cycloidea and PCF transcription factor 2

>>>Show top 3 blast result

Query id	Subject id	alignment length	mis matches	gap openings	query start	query end	subject start	subject end	% identity	e-value	bit score
g352230	AT4G18390.2	316	121	9	50	336	20	309	44.30	4e-51	199
g352230	AT4G18390.1	316	121	9	50	336	20	309	44.30	4e-51	199
g352230	AT1G30210.2	186	51	4	53	237	31	186	55.91	8e-41	164

Ortholog group

Species	Genes
Allium cepa	g352230.t1
Allium fistulosum	AfisC8G04208
Allium sativum	Asa1G01424.1; Asa2G05655.1; Asa6G02784.1; Asa8G03822.1
Arabidopsis thaliana	AT1G30210.1; AT1G30210.2
Oryza sativa	LOC_Os12g02090.1

Pfam domain

Pfam ID	Pfam name	type	alignment_start	alignment_end	bit_score	Evalue
PF03634.10	TCP	Family	71	205	130.7	6e-38

Gene Ontology

Accession	Ontology	Name
GO:0003674	F	molecular_function
GO:0003676	F	nucleic acid binding
GO:0003677	F	DNA binding
GO:0003700	F	transcription factor activity, sequence-specific DNA binding
GO:0005488	F	binding
GO:0006355	P	regulation of transcription, DNA-templated
GO:0007275	P	multicellular organism development
GO:0009653	P	anatomical structure morphogenesis
GO:0008150	P	biological_process
GO:0008285	P	negative regulation of cell proliferation
GO:0009314	P	response to radiation
GO:0009416	P	response to light stimulus
GO:0009628	P	response to abiotic stimulus
GO:0009637	P	response to blue light
GO:0009889	P	regulation of biosynthetic process
GO:0009891	P	positive regulation of biosynthetic process
GO:0009893	P	positive regulation of metabolic process
GO:0009965	P	leaf morphogenesis
GO:0009987	P	cellular process
GO:0010016	P	shoot system morphogenesis
GO:0010099	P	regulation of photomorphogenesis
GO:0010468	P	regulation of gene expression
GO:0010556	P	regulation of macromolecule biosynthetic process
GO:0010557	P	positive regulation of macromolecule biosynthetic process
GO:0010604	P	positive regulation of macromolecule metabolic process
GO:0045935	P	positive regulation of nucleobase-containing compound metabolic process
GO:0019219	P	regulation of nucleobase-containing compound metabolic process
GO:0019222	P	regulation of metabolic process
GO:0030154	P	cell differentiation
GO:0031323	P	regulation of cellular metabolic process
GO:0031325	P	positive regulation of cellular metabolic process
GO:0031326	P	regulation of cellular biosynthetic process
GO:0031328	P	positive regulation of cellular biosynthetic process
GO:0032501	P	multicellular organismal process
GO:0032502	P	developmental process
GO:0040034	P	regulation of development, heterochronic
GO:0042127	P	regulation of cell proliferation
GO:0045962	P	positive regulation of development, heterochronic
GO:0048366	P	leaf development
GO:0048367	P	shoot system development
GO:0048518	P	positive regulation of biological process
GO:0048519	P	negative regulation of biological process
GO:0048522	P	positive regulation of cellular process
GO:0048523	P	negative regulation of cellular process
GO:0048580	P	regulation of post-embryonic development
GO:0048582	P	positive regulation of post-embryonic development
GO:0048583	P	regulation of response to stimulus
GO:0048584	P	positive regulation of response to stimulus
GO:0048731	P	system development
GO:0048827	P	phyllome development
GO:0048856	P	anatomical structure development
GO:0048869	P	cellular developmental process
GO:0050789	P	regulation of biological process
GO:0050793	P	regulation of developmental process
GO:0050794	P	regulation of cellular process
GO:0050896	P	response to stimulus
GO:0051094	P	positive regulation of developmental process
GO:0051171	P	regulation of nitrogen compound metabolic process
GO:0051173	P	positive regulation of nitrogen compound metabolic process
GO:0051239	P	regulation of multicellular organismal process
GO:0051240	P	positive regulation of multicellular organismal process
GO:0051252	P	regulation of RNA metabolic process
GO:0051254	P	positive regulation of RNA metabolic process
GO:0060255	P	regulation of macromolecule metabolic process
GO:0065007	P	biological regulation
GO:0080090	P	regulation of primary metabolic process
GO:0097159	F	organic cyclic compound binding
GO:0099402	P	plant organ development
GO:1901363	F	heterocyclic compound binding
GO:1902680	P	positive regulation of RNA biosynthetic process
GO:1903506	P	regulation of nucleic acid-templated transcription
GO:1903508	P	positive regulation of nucleic acid-templated transcription
GO:2000026	P	regulation of multicellular organismal development
GO:2000030	P	regulation of response to red or far red light
GO:2000112	P	regulation of cellular macromolecule biosynthetic process
GO:2000306	P	positive regulation of photomorphogenesis
GO:2001141	P	regulation of RNA biosynthetic process
GO:0140110
GO:1905392

KEGG pathway

KO	Name	Enzyme ID	Pathway	Pathway ID
-	-	-	-	-

Expression pattern in different tissues

Expression pattern in BioProjects

Co-expression network