result

Gene information

Detail information of g356003

Location

Gene	Chr	Start	End	Strand
g356003	Scaffold_71346:HRSCAF_454432	47458	48580	-

Sequences

CDS

Protein

Gene

>g356003.t1
ATGGACTTTCCTTATGAAAACCCTAATTACTACTTCATACCAAATCCCACCTTCTCTTCTTCTGACATAGATAAAATTACAGTCGGCAGTCAGCTACAAACCATTCAAAATCAAAACCGGATTCCTCAATGGAGTCAACAAGAAGCACAAGCTCTTTTGAATATTAGGGCTGAACTCGATAGGAAGTTCACTGAGATCAAAAGAAATAAAGCGCTTTGGACTGAGATTTCTACACAGATGCAGCAAATAGGGTACAACCGAACCCCAGAGCAGTGTAAATCTAAGTGGAAGAACTTAGTCAATTGCTACAAGGTTTATTACGTACACTCGTCTCCGTTGCTATTAAGATTTGCATGTGGTCAATTAGAAATTTAGAATATTTACTCTCCTTTTCTTTTTGGTTTTTCATGGATATATCATTGTTGTACAGTACGATTTTCTATTAAAAAATTTCTTTCACAGAAAAATATTTTCTGTTCACTTATCTGTATGTCTATTCTAACATTTGATCTATGTATTGATGTAATATACATGAGAATATTGCTTTATTGCATCATACAAATGAAGTAAAAAAAAATTTGGCTAATAGAATAAATAAATAAACTTTGCAAGATATCAATCCATCTTATATAGTTATGTCCTAACATATTGCAATAAATTGGTATAACAAACATATATATAGGGTAAATCTGACAGGAAATTCCCATTCCACGAGGAAATGAGAAGCATTTTCTCTGAAAGAATGGAAAGATCTATTCATTTAACTAAAGGGAAGATGAAAGCCGATGACGGAGATGAGCAAGAAGAGGATAAGCGCATTAGCATGAAAAAGAGAAAGAAAGCCATGTGCACCGACGCTGTAGAAGTTTTAAGAGAATTTGGAAGAAAGCAAATAGAAATGGAAACGAGAATGATGGAATCTTTAGAAGCTAGAGAAGCCGAAAGATGGTGCAAGGAAGAGGAATGGAAGAAGGACCTAATAGCGGCATATGAGGAGAGGAATGCAGTGGAGAGAAGATGGAGAGAAAGAGAAGAAGAGAAACAGCTAAGGGATGATATAAGAGATGAAAGAAGGCATGAGATGATAACCACCACCTTAGCAAAGATTGATGACTTTATCTAG

Functional annotation

Database	accession number	e-value	annotation
nr	KAF3336981.1	1.0e-29	trihelix transcription factor GT-3b-like protein
trEMBL	A0A833RJG8	7.4e-30	Trihelix transcription factor GT-3b-like protein

Best hit in Arabidopsis

TAIR id	% identity	e-value	bit score	gene aliases	Short description
AT2G38250.1	37.10	8e-23	103		Homeodomain-like superfamily protein

>>>Show top 3 blast result

Query id	Subject id	alignment length	mis matches	gap openings	query start	query end	subject start	subject end	% identity	e-value	bit score
g356003	AT2G38250.1	248	115	4	39	246	37	283	37.10	8e-23	103
g356003	AT5G01380.1	97	42	1	40	129	48	144	49.48	2e-20	95.9
g356003	AT3G25990.1	95	54	1	40	124	51	145	32.63	8e-11	64.3

Ortholog group

Species	Genes
Allium cepa	g356003.t1; g358662.t1; g358663.t1; g358665.t1; g418652.t1; g418655.t1; g418656.t1; g419417.t1
Allium fistulosum	AfisC5G03632; AfisC5G03633; AfisC5G03634; AfisC5G03636; AfisC5G03639; AfisC5G03641; AfisC7G01592; AfisC8G00903; AfisC8G01662
Allium sativum	Asa7G04078.1; Asa7G04079.1
Arabidopsis thaliana	AT2G38250.1; AT5G01380.1
Oryza sativa	LOC_Os05g03740.1

Pfam domain

Pfam ID	Pfam name	type	alignment_start	alignment_end	bit_score	Evalue
PF13837.3	Myb_DNA-bind_4	Domain	43	119	65.0	5.6e-18

Gene Ontology

Accession	Ontology	Name
GO:0005515	F	protein binding
GO:0005622	C	intracellular
GO:0005575	C	cellular_component
GO:0000981	F	RNA polymerase II transcription factor activity, sequence-specific DNA binding
GO:0003674	F	molecular_function
GO:0003676	F	nucleic acid binding
GO:0003677	F	DNA binding
GO:0003700	F	transcription factor activity, sequence-specific DNA binding
GO:0005488	F	binding
GO:0005623	C	cell
GO:0005634	C	nucleus
GO:0005654	C	nucleoplasm
GO:0005730	C	nucleolus
GO:0043231	C	intracellular membrane-bounded organelle
GO:0006355	P	regulation of transcription, DNA-templated
GO:0006357	P	regulation of transcription from RNA polymerase II promoter
GO:0008150	P	biological_process
GO:0042802	F	identical protein binding
GO:0009889	P	regulation of biosynthetic process
GO:0010468	P	regulation of gene expression
GO:0010556	P	regulation of macromolecule biosynthetic process
GO:0016592	C	mediator complex
GO:0019219	P	regulation of nucleobase-containing compound metabolic process
GO:0019222	P	regulation of metabolic process
GO:0031323	P	regulation of cellular metabolic process
GO:0031326	P	regulation of cellular biosynthetic process
GO:0031974	C	membrane-enclosed lumen
GO:0031981	C	nuclear lumen
GO:0032991	C	macromolecular complex
GO:0043226	C	organelle
GO:0043227	C	membrane-bounded organelle
GO:0043228	C	non-membrane-bounded organelle
GO:0043229	C	intracellular organelle
GO:0043232	C	intracellular non-membrane-bounded organelle
GO:0043233	C	organelle lumen
GO:0043565	F	sequence-specific DNA binding
GO:0044422	C	organelle part
GO:0044424	C	intracellular part
GO:0044428	C	nuclear part
GO:0044446	C	intracellular organelle part
GO:0044451	C	nucleoplasm part
GO:0044464	C	cell part
GO:0050789	P	regulation of biological process
GO:0050794	P	regulation of cellular process
GO:0051171	P	regulation of nitrogen compound metabolic process
GO:0051252	P	regulation of RNA metabolic process
GO:0060255	P	regulation of macromolecule metabolic process
GO:0065007	P	biological regulation
GO:0070013	C	intracellular organelle lumen
GO:0080090	P	regulation of primary metabolic process
GO:0097159	F	organic cyclic compound binding
GO:1901363	F	heterocyclic compound binding
GO:1903506	P	regulation of nucleic acid-templated transcription
GO:2000112	P	regulation of cellular macromolecule biosynthetic process
GO:2001141	P	regulation of RNA biosynthetic process
GO:0140110

KEGG pathway

KO	Name	Enzyme ID	Pathway	Pathway ID
-	-	-	-	-

Expression pattern in different tissues

Expression pattern in BioProjects

Co-expression network