result

Gene information

Detail information of g374579

Location

Gene	Chr	Start	End	Strand
g374579	Scaffold_73658:HRSCAF_456744	519094	520255	-

Sequences

CDS

Protein

Gene

>g374579.t1
ATGGTCGACATAACCTCAATTTTCATCCTTGGTAAAGAACTAGGCCGAGGCCAATTTGGCATCACATACATATGTACCGAACGTGCAACTGGCTTAAAATATGCTTGCAAATCTGTATCGAAAAGAAAACTTGTAACTAAAACCGATGTATATGATATAAGAAGAGAAGTGATGATCCTTCAGCATCTCACTGGTAAGCCAAATATTGTAGATTTCAAAGGAGCTTATGAGGATAGGCAAAACGTGCATTTGGTCATGGAGCTGTGTTCTAGAGGAGAGCTTTTCGATAGGATCATTGCTAAAGGGAGCTACTCGGAGAAAAAAGCTTCTTTTATATGTAGAAGCATTGTGCGTGTTGTCCATGTTTTCCATTTCGTGGGTGTCATGCATAGAGATCTTAAGCCTGAAAATTTTCTTCTAGTCAGTCGAGATGAGGATTCTCCTCTTAAAGCCACTGATTTTTGCCTCTCTGTGTTCATCGAAGAAGGTCAGTTAATTTATGAATACGAAATGTCATGTGTATATGAAGCAGAAATGCAATATTTAAATAATGTGCGTAGGGAAAATATACCGTGAAATAGTAGGAAGTAATTATGTAGCACCTGAGGTGCTGCACAGGAGCTATGGGAAAGAAATCGATGTCTGGAGTGCAGGAGTTATCCTCTACATTCTTCTTTGTGGAGTGCCACCATTATGGGCAGGTATTATAATTGATGATGATTTCTTCATAATAACTGTTTCATTTGATTTTGACGAAAGACTGTTGAAAAATGAATGCAGAAACAGGAAGTGGAATATTTGATACAATACTACAGGGTGACTTTGATTTGGAAAATGATCCATGGCAAACTATATCTTCTAGTGCAAAAGACTTGATCAGATAAATTTTGACTAGGGATCCTAAGAAAAGAATCACAGCTGCCCAAGCACTGGGTATAAAACACGAACAAGAAAAAAATGTCTTAAAAATTTATTTTTGAGAAAGTTGCTAGTGCTATAAACAATTTTTTGTGCAGAGCATCCGTGGCTTAGAGAAGATGGAGATGCATCGGATAAGCCCATGGGCAGTGCAGTTTTAAATGGAATGAAGCAATTCAGAGCAATGAATAAGCTTAAGCAACTTGCATTAAAGGTACTAGTCAAGCATGCATTTGTGATTTAA

Functional annotation

Database	accession number	e-value	annotation
nr	ONK72672.1	5.9e-113	uncharacterized protein A4U43_C04F21880
Swissprot	Q8RWL2.2	2.1e-99	Calcium-dependent protein kinase 29
trEMBL	A0A5P1F3D2	4.2e-113	Calcium-dependent protein kinase 29

Best hit in Arabidopsis

TAIR id	% identity	e-value	bit score	gene aliases	Short description
AT1G76040.2	60.98	3e-103	371	CPK29	calcium-dependent protein kinase 29

>>>Show top 3 blast result

Query id	Subject id	alignment length	mis matches	gap openings	query start	query end	subject start	subject end	% identity	e-value	bit score
g374579	AT1G76040.2	305	66	3	1	253	105	408	60.98	3e-103	371
g374579	AT3G20410.1	303	71	2	3	253	86	388	59.41	5e-102	367
g374579	AT1G50700.1	303	74	2	3	253	68	370	58.42	2e-100	361

Ortholog group

Species	Genes
-	-

Pfam domain

Pfam ID	Pfam name	type	alignment_start	alignment_end	bit_score	Evalue
PF00069.22	Pkinase	Domain	11	211	181.7	1.5e-53

Gene Ontology

Accession	Ontology	Name
GO:0005886	C	plasma membrane
GO:0005515	F	protein binding
GO:0005622	C	intracellular
GO:0005575	C	cellular_component
GO:0001101	P	response to acid chemical
GO:0008152	P	metabolic process
GO:0003674	F	molecular_function
GO:0016020	C	membrane
GO:0006952	P	defense response
GO:0050832	P	defense response to fungus
GO:0003824	F	catalytic activity
GO:0004672	F	protein kinase activity
GO:0004674	F	protein serine/threonine kinase activity
GO:0004683	F	calmodulin-dependent protein kinase activity
GO:0007165	P	signal transduction
GO:0035556	P	intracellular signal transduction
GO:0005488	F	binding
GO:0005516	F	calmodulin binding
GO:0005623	C	cell
GO:0005634	C	nucleus
GO:0005737	C	cytoplasm
GO:0043231	C	intracellular membrane-bounded organelle
GO:0006464	P	cellular protein modification process
GO:0006468	P	protein phosphorylation
GO:0006793	P	phosphorus metabolic process
GO:0006796	P	phosphate-containing compound metabolic process
GO:0006807	P	nitrogen compound metabolic process
GO:0006950	P	response to stress
GO:0007154	P	cell communication
GO:0008150	P	biological_process
GO:0009605	P	response to external stimulus
GO:0009607	P	response to biotic stimulus
GO:0051707	P	response to other organism
GO:0009620	P	response to fungus
GO:0009719	P	response to endogenous stimulus
GO:0009725	P	response to hormone
GO:0009737	P	response to abscisic acid
GO:0009738	P	abscisic acid-activated signaling pathway
GO:0009755	P	hormone-mediated signaling pathway
GO:0009931	F	calcium-dependent protein serine/threonine kinase activity
GO:0009987	P	cellular process
GO:0010033	P	response to organic substance
GO:0010857	F	calcium-dependent protein kinase activity
GO:0016301	F	kinase activity
GO:0016310	P	phosphorylation
GO:0016740	F	transferase activity
GO:0016772	F	transferase activity, transferring phosphorus-containing groups
GO:0016773	F	phosphotransferase activity, alcohol group as acceptor
GO:0018105	P	peptidyl-serine phosphorylation
GO:0018193	P	peptidyl-amino acid modification
GO:0018209	P	peptidyl-serine modification
GO:0019538	P	protein metabolic process
GO:0023052	P	signaling
GO:0070887	P	cellular response to chemical stimulus
GO:0032870	P	cellular response to hormone stimulus
GO:0033993	P	response to lipid
GO:0036211	P	protein modification process
GO:0042221	P	response to chemical
GO:0043170	P	macromolecule metabolic process
GO:0043207	P	response to external biotic stimulus
GO:0043226	C	organelle
GO:0043227	C	membrane-bounded organelle
GO:0043229	C	intracellular organelle
GO:0043412	P	macromolecule modification
GO:0044237	P	cellular metabolic process
GO:0044238	P	primary metabolic process
GO:0044260	P	cellular macromolecule metabolic process
GO:0044267	P	cellular protein metabolic process
GO:0044424	C	intracellular part
GO:0044464	C	cell part
GO:0046777	P	protein autophosphorylation
GO:0047484	P	regulation of response to osmotic stress
GO:0048518	P	positive regulation of biological process
GO:0048583	P	regulation of response to stimulus
GO:0048584	P	positive regulation of response to stimulus
GO:0050789	P	regulation of biological process
GO:0050794	P	regulation of cellular process
GO:0050896	P	response to stimulus
GO:0051704	P	multi-organism process
GO:0051716	P	cellular response to stimulus
GO:0065007	P	biological regulation
GO:0071215	P	cellular response to abscisic acid stimulus
GO:0071229	P	cellular response to acid chemical
GO:0071310	P	cellular response to organic substance
GO:0071396	P	cellular response to lipid
GO:0071495	P	cellular response to endogenous stimulus
GO:0071704	P	organic substance metabolic process
GO:0071944	C	cell periphery
GO:0080134	P	regulation of response to stress
GO:0097305	P	response to alcohol
GO:0097306	P	cellular response to alcohol
GO:0098542	P	defense response to other organism
GO:1901000	P	regulation of response to salt stress
GO:1901002	P	positive regulation of response to salt stress
GO:1901564	P	organonitrogen compound metabolic process
GO:1901700	P	response to oxygen-containing compound
GO:1901701	P	cellular response to oxygen-containing compound
GO:0140096

KEGG pathway

KO	Name	Enzyme ID	Pathway	Pathway ID
K06180	rluD; 23S rRNA pseudouridine1911/1915/1917 synthase	EC:5.4.99.23	-	-
K13412	CPK; calcium-dependent protein kinase	EC:2.7.11.1	Plant-pathogen interaction	ko04626

Expression pattern in different tissues

Expression pattern in BioProjects

Co-expression network