result

Gene information

Detail information of g385195

Location

Gene	Chr	Start	End	Strand
g385195	Scaffold_74933:HRSCAF_458019	207803	209219	+

Sequences

CDS

Protein

Gene

>g385195.t1
ATGGTAGTGAAAATACTTCAAAAAATAAAAAGATGGCGGTGGACTGATGAATTGCATGAAAAATTTATCAGCGCTGTTAATGAACTTGGCTTAGACAGTATGCTATTTTGTCTATTTTTTGCTATTAGCGTCTTATAGTTATTTTTTAGACCTGTGTCTAAGCTTATTATCAATGTTCTTCTTCTTTTTGCAGAGGCCTGCCCCAAGAAAATATCAGAATTGATGGGTGTACCGAACTTGTCTACGAAAAGTGTTAGTAGTTACTTGCAGGTTTTATTTTGAAACTTCTTTGGCATTATAGTTGAAACTCGTCACATATTCTTTTAGCTTCTTCATTCTCTATAAAATTCTGAAAATCTTGTCTTCTACAGCCTTATAGTATTTAGGTGAAACAAAAGTTCTTAAACATGTCATGAAAAAGGCTTCCACTTTTAAGTATTTGAGGAAAAATAGAATACACAAATTAAGCTAAGTTTTCCCTGTAAAATACTAATGTCACATTCTTCTAGCCCTACATGTACTTAGATGCATACATAATATCTTGAGCTTATTTGTAAGTAGAGCATTAACACTATAGACATTTTTGCATTTTATAGATTACAGAAATAAAATTTGTTTGCATATTTTTAGAGTTGAATAGTAGAACAACTTGCTTTTAATATAATTTTGTAAGACACCCCAAGTGTTATGTGATTGCTTAAATCTGTTAACAGCTAGACAGACAAATATTCTGATAAATTATATTTTCCAATTTTCTAAGCATCTATAAGTAAATGTACACAAATTCATGATTGAAATGAATAATAAATTTTCCAGGTAGCTTTTCTATCAAAATAAAAGCGTATTAATATAAGTACATGAACTTGGATGCATTCATACACTACAAACCTTTTATCCTGTTCTGTACATTTTGATAGTTTTTACACTTACAGAAATAAAGAGATATAAGCATGTCTCTCTTTGTATTATATCATGACATACGTATCTATATTTCAGAAACATTAGTTTATAACTTCATATACATTAAGCTGCCATGAAACTTGTACAGAAATTCAGAGAAACTGTCAAGCAAAAGGGCGTTGTAGATTGGACAAAAATCACTTCGAAAACGGCAAGTGAACATGTGCAAAACAATAAATTGTCAGCTATGCAACAATCATCATCTTCTCAACCTATCTTAAGCACAAATCAAATTCCAGAATCTGAATCTCAAGGACGAATTGGAAATATGCTGAACTCTCAGTCACCAGGTACACCTATTGTGCCGGAACAGTCAGTTCCTATATTCAGATTGCAGAATTATGCACCTATAGTGCCTAATGGGAACAACTATGTTCATGCACCATGCAACCCCAGTCTTATTGGACAAAGTAATGTTCATATATCTCCTTCTCCACAATTGGCAGAAAAACTCTAA

Functional annotation

Database	accession number	e-value	annotation
nr	ONK75335.1	3.5e-11	uncharacterized protein A4U43_C03F15770
Swissprot	P62598.2	3.4e-11	Two-component response regulator ARR12
trEMBL	A0A5P1FAE1	2.5e-11	HTH myb-type domain-containing protein

Best hit in Arabidopsis

TAIR id	% identity	e-value	bit score	gene aliases	Short description
AT2G25180.1	43.82	3e-14	74.7	ARR12;RR12	response regulator 12

>>>Show top 3 blast result

Query id	Subject id	alignment length	mis matches	gap openings	query start	query end	subject start	subject end	% identity	e-value	bit score
g385195	AT2G25180.1	89	49	1	7	94	193	281	43.82	3e-14	74.7
g385195	AT2G01760.1	100	49	1	8	107	199	286	39.00	1e-13	72.4
g385195	AT4G16110.1	96	44	2	11	105	218	303	42.71	3e-13	71.2

Ortholog group

Species	Genes
Allium cepa	g385195.t1
Allium fistulosum	AfisC3G05734
Allium sativum	Asa2G00087.1
Arabidopsis thaliana
Oryza sativa

Pfam domain

Pfam ID	Pfam name	type	alignment_start	alignment_end	bit_score	Evalue
PF00249.28	Myb_DNA-binding	Domain	13	60	38.1	1.2e-09

Gene Ontology

Accession	Ontology	Name
GO:0000156	F	phosphorelay response regulator activity
GO:0000160	P	phosphorelay signal transduction system
GO:0005515	F	protein binding
GO:0005622	C	intracellular
GO:0005575	C	cellular_component
GO:0003674	F	molecular_function
GO:0003700	F	transcription factor activity, sequence-specific DNA binding
GO:0007165	P	signal transduction
GO:0035556	P	intracellular signal transduction
GO:0005488	F	binding
GO:0005623	C	cell
GO:0005634	C	nucleus
GO:0043231	C	intracellular membrane-bounded organelle
GO:0006355	P	regulation of transcription, DNA-templated
GO:0007154	P	cell communication
GO:0007275	P	multicellular organism development
GO:0009653	P	anatomical structure morphogenesis
GO:0009888	P	tissue development
GO:0007568	P	aging
GO:0008150	P	biological_process
GO:0042802	F	identical protein binding
GO:0009719	P	response to endogenous stimulus
GO:0009723	P	response to ethylene
GO:0009725	P	response to hormone
GO:0009735	P	response to cytokinin
GO:0009736	P	cytokinin-activated signaling pathway
GO:0009755	P	hormone-mediated signaling pathway
GO:0009873	P	ethylene-activated signaling pathway
GO:0009889	P	regulation of biosynthetic process
GO:0009987	P	cellular process
GO:0010015	P	root morphogenesis
GO:0010033	P	response to organic substance
GO:0010073	P	meristem maintenance
GO:0010075	P	regulation of meristem growth
GO:0010082	P	regulation of root meristem growth
GO:0010119	P	regulation of stomatal movement
GO:0010150	P	leaf senescence
GO:0010468	P	regulation of gene expression
GO:0010556	P	regulation of macromolecule biosynthetic process
GO:0019219	P	regulation of nucleobase-containing compound metabolic process
GO:0019222	P	regulation of metabolic process
GO:0022622	P	root system development
GO:0023052	P	signaling
GO:0070887	P	cellular response to chemical stimulus
GO:0031323	P	regulation of cellular metabolic process
GO:0031326	P	regulation of cellular biosynthetic process
GO:0032501	P	multicellular organismal process
GO:0032502	P	developmental process
GO:0032870	P	cellular response to hormone stimulus
GO:0040008	P	regulation of growth
GO:0042221	P	response to chemical
GO:0043226	C	organelle
GO:0043227	C	membrane-bounded organelle
GO:0043229	C	intracellular organelle
GO:0044424	C	intracellular part
GO:0044464	C	cell part
GO:0048364	P	root development
GO:0048366	P	leaf development
GO:0048367	P	shoot system development
GO:0048507	P	meristem development
GO:0048509	P	regulation of meristem development
GO:0048580	P	regulation of post-embryonic development
GO:0048638	P	regulation of developmental growth
GO:0048731	P	system development
GO:0048827	P	phyllome development
GO:0048856	P	anatomical structure development
GO:0050789	P	regulation of biological process
GO:0050793	P	regulation of developmental process
GO:0050794	P	regulation of cellular process
GO:0050896	P	response to stimulus
GO:0051171	P	regulation of nitrogen compound metabolic process
GO:0051239	P	regulation of multicellular organismal process
GO:0051252	P	regulation of RNA metabolic process
GO:0051716	P	cellular response to stimulus
GO:0060089	F	molecular transducer activity
GO:0060255	P	regulation of macromolecule metabolic process
GO:0065007	P	biological regulation
GO:0071310	P	cellular response to organic substance
GO:0071368	P	cellular response to cytokinin stimulus
GO:0071369	P	cellular response to ethylene stimulus
GO:0071495	P	cellular response to endogenous stimulus
GO:0080050	P	regulation of seed development
GO:0080090	P	regulation of primary metabolic process
GO:0080113	P	regulation of seed growth
GO:0099402	P	plant organ development
GO:1903506	P	regulation of nucleic acid-templated transcription
GO:2000026	P	regulation of multicellular organismal development
GO:2000112	P	regulation of cellular macromolecule biosynthetic process
GO:2000241	P	regulation of reproductive process
GO:2000280	P	regulation of root development
GO:2001141	P	regulation of RNA biosynthetic process
GO:0090693
GO:0140110
GO:1905392

KEGG pathway

KO	Name	Enzyme ID	Pathway	Pathway ID
K14491	ARR-B; two-component response regulator ARR-B family	EC:-	Plant hormone signal transduction	ko04075

Expression pattern in different tissues

Expression pattern in BioProjects

Co-expression network