result

Gene information

Detail information of g391331

Location

Gene	Chr	Start	End	Strand
g391331	Scaffold_75656:HRSCAF_458742	67697	68910	-

Sequences

CDS

Protein

Gene

>g391331.t1
ATGGAAACAAGCAAGCTGCTCAGAAGCCATGGTGACATTAGCAGCAGCAACAATACCTGTCAAGATATTCAATTACAAGTGGCTCCTTTCGTCTCCAAAATTTATCAAATGGTCAATGATCCGAGGACCGACCTTTTAATAAGATGGGGAAGAGAAAATAATAGCTTCTTAGTGTTCAATCCTTCGGATTTTTCCATCCTTTTGCTCCCTCTTTATTTCAAGCATGGCAATTTCTCTAGTTTTGTCCGCCAACTCAATACTTACGTGAGTTCTCTCATCTCTGCCTCATATTTTTGAACAGTAGTCCCGGATATTTTAGCTTCAACTTTCAGTTATCAAGAAACTTTAATTTGTTAATGTTTTTTAGTTAGTTTTGTTTATTGAATTTACCCTTTGTTTTGTGTATAAGTTCCGTTCATCATAAATCTCCATAAAAGTGATGATATGATTGACTTTTTACTCCTTGAAATTGGAGAAAAAACGACTTACTTTGAAACCTAGAGAAAATTTCTCAACTGGTTGAGTTTTGTCGATTTTTAACTATTCTCGGTTCTTCATTTATTATTATTATTTTTTCACGGTTTTTTCGATATTTGATTTTCCTACAGGGATTCAAAAAGATTGACCCAGACCACTGGGAGTTCGCACATGAGTCATTTCTACGTTGCCAACTGCAACTCTTGCCACATATAGTAAGAAGAAATAATAGGAAAAATCATGAAAACGAAGAGACGGGGCATGACACAAAAGAAGCATATGATGAAGAAAGCAATGAGATGTTATTTAAAGAAGTTGTAAAACTACGCAAAGAGCAAAAATTGCTAGAAGAAGAACTGCAAGGCATGAACCGAAGACTTCAAATTACTGAACGAAGCCCGCATCAAATGTATTCATTTCTTGTTAAAGTAGCAGAGGACCCTGAACTGCTACCTAGGCTGATCCTCTCAAAGAAAAGGCGAATATTCGACGAGCAAGAAAAGAAAAGAACATTGCCTGGTACGGTAGTTATGGATAATGAATTTCCTGCTCCATTACCTCAATATTTTGAGAGAGATTACAGTCTACAGTCAGTGAATTTCGGCATTATAGACGATAACCTTGCTGTAAGTAAAATGGGATTGGAAAATCAGGTGGTTTTGCTGCCAGAGCACGGTGAAACAGAGATGAAGAAAGTGGCTTACCCATTTTCATTGTTAGGCCATATGTTTCTCTAG

Functional annotation

Database	accession number	e-value	annotation
nr	XP_020268219.1	2.9e-44	heat stress transcription factor C-1b-like
Swissprot	Q6VBA4.2	7.5e-37	Heat stress transcription factor 2
trEMBL	A0A5P1ESK9	2.1e-44	HSF_DOMAIN domain-containing protein

Best hit in Arabidopsis

TAIR id	% identity	e-value	bit score	gene aliases	Short description
AT3G24520.1	50.77	5e-51	197	AT-HSFC1;HSFC1	heat shock transcription factor C1

>>>Show top 3 blast result

Query id	Subject id	alignment length	mis matches	gap openings	query start	query end	subject start	subject end	% identity	e-value	bit score
g391331	AT3G24520.1	195	80	3	27	216	15	198	50.77	5e-51	197
g391331	AT5G16820.2	223	89	6	27	213	25	242	41.70	1e-39	160
g391331	AT5G16820.1	223	89	6	27	213	25	242	41.70	1e-39	160

Ortholog group

Species	Genes
Allium cepa	g391331.t1
Allium fistulosum	AfisC5G01546
Allium sativum	Asa0G01036.1
Arabidopsis thaliana
Oryza sativa

Pfam domain

Pfam ID	Pfam name	type	alignment_start	alignment_end	bit_score	Evalue
PF00447.14	HSF_DNA-bind	Family	30	119	94.3	4.9e-27

Gene Ontology

Accession	Ontology	Name
GO:0005622	C	intracellular
GO:0005575	C	cellular_component
GO:0001101	P	response to acid chemical
GO:0003674	F	molecular_function
GO:0003700	F	transcription factor activity, sequence-specific DNA binding
GO:0005623	C	cell
GO:0005634	C	nucleus
GO:0043231	C	intracellular membrane-bounded organelle
GO:0006355	P	regulation of transcription, DNA-templated
GO:0006950	P	response to stress
GO:0006970	P	response to osmotic stress
GO:0008150	P	biological_process
GO:0009628	P	response to abiotic stimulus
GO:0009719	P	response to endogenous stimulus
GO:0009725	P	response to hormone
GO:0009737	P	response to abscisic acid
GO:0009889	P	regulation of biosynthetic process
GO:0010033	P	response to organic substance
GO:0010468	P	regulation of gene expression
GO:0010556	P	regulation of macromolecule biosynthetic process
GO:0019219	P	regulation of nucleobase-containing compound metabolic process
GO:0019222	P	regulation of metabolic process
GO:0031323	P	regulation of cellular metabolic process
GO:0031326	P	regulation of cellular biosynthetic process
GO:0033993	P	response to lipid
GO:0042221	P	response to chemical
GO:0043226	C	organelle
GO:0043227	C	membrane-bounded organelle
GO:0043229	C	intracellular organelle
GO:0044424	C	intracellular part
GO:0044464	C	cell part
GO:0050789	P	regulation of biological process
GO:0050794	P	regulation of cellular process
GO:0050896	P	response to stimulus
GO:0051171	P	regulation of nitrogen compound metabolic process
GO:0051252	P	regulation of RNA metabolic process
GO:0060255	P	regulation of macromolecule metabolic process
GO:0065007	P	biological regulation
GO:0080090	P	regulation of primary metabolic process
GO:0097305	P	response to alcohol
GO:1901700	P	response to oxygen-containing compound
GO:1903506	P	regulation of nucleic acid-templated transcription
GO:2000112	P	regulation of cellular macromolecule biosynthetic process
GO:2001141	P	regulation of RNA biosynthetic process
GO:0140110

KEGG pathway

KO	Name	Enzyme ID	Pathway	Pathway ID
K09419	HSFF; heat shock transcription factor, other eukaryote	EC:-	-	-

Expression pattern in different tissues

Expression pattern in BioProjects

Co-expression network